search

Teichlab / scg_lib_structs

Collections of library structure and sequence of popular single cell genomic methods
428 stars 89 forks source link

SPLiT-seq corrections #13

Closed arnavm closed 2 years ago

arnavm commented 3 years ago

Hi,

I've noticed some differences in the oligonucleotide sequences for SPLiT-seq between different protocol versions.

This is the structure of read2 based on the preprint, which matches what you currently have: [10-bp UMI][8-bp Round3 barcode]GTGGCCGATGTTTCGCATCGGCGTACGACT[8-bp Round2 barcode]ATCCACGTGCTTGAGCGCGCTGCATACTTG[8-bp Round1 barcode]CCCATGATCGTCCGAAGGCCAGAGCATTCG(dT)

This is the structure of read2 based on the published manuscript: [10-bp UMI][8-bp Round3 barcode]GTGGCCGATGTTTCGCATCGGCGTACGACT[8-bp Round2 barcode]ATCCACGTGCTTGAGAGGCCAGAGCATTCG[8-bp Round1 barcode](dT or N6). This sequence ends with either poly(dT)VN or NNNNNN depending on if the oligo primes off poly(A) or random hexamers. I don't know why the oligo design changed between preprint and acceptance.

Finally, the oligo design has changed again in the commercial version of SPLiT-seq by Parse BioSciences. This is the new read2 structure: [10-bp UMI][8-bp Round3 barcode]GTGGCCGATGTTTCGCATCGGCGTACGACT[8-bp Round2 barcode]ATCCACGTGCTTGAGACTGTGG[8-bp Round1 barcode](dT)

As far as I can tell, all three versions have a 6 bp i7 index between the Illumina TruSeq and P7 sequences.

dbrg77 commented 3 years ago

Hi @arnavm ,

Thanks for the info.

I was not aware there was a commercial SPLiT-seq. It looks like they have some interesting products there.

The current workflow and oligo sequences were taken from their google site back in early 2017 when the paper was still in the preprint stage. The link doesn't seem to work currently.

I did not know they changed the oligo slightly in the final publication, and I will check the final version of the paper to have a look.

Not sure how much difference the changes make. The basic idea is still the same. For now, I will put a link on the webpage to this thread to let people know there are different versions of the protocol.

Thanks.

Regards, Xi

arnavm commented 3 years ago

Hi Xi,

Sounds good! I agree, for 99% of users, there should be no practical difference. This is more for completeness’s sake, as well as to help anyone interested in developing modifications to the technique. It should also be noted that Parse BioSciences’ analysis software, split-pipe, is not compatible with libraries generated using the original oligonucleotides (either those in the preprint or the published Science paper).

— Arnav

dbrg77 commented 2 years ago

Hi Arnav,

I have now archived the old SPLiT-seq page, and created a new SPLiT-seq page based on the science2018 publication. The old one based on the preprint can still be accessed. In addition, I also point to this thread to let people know that there is a commercial version of this method.

Closing for now, but feel free to re-open.

Thanks.

Xi

ghost commented 2 years ago

Hello! Do you know by chance the sequence of the RT primers (1st barcode round) used in the commercial version by Parse? I am interested in the adaptor sequence in the RT primer used for the following ligation of 2nd barcode

dbrg77 commented 2 years ago

Hi @vitachambev

I missed the comment the other day. Unfortunately, I don't have information. There are no fastq files on their website last time I checked, and the kits are not available in China.

I might check with them to see if that's something they can share. In the meantime, maybe @arnavm knows ???

Regards, Xi