tracer crashes after Kallisto

[zji90]

Hi, I am running tracer on the example cell1_1.fastq and cell1_2.fastq that come with the software package. All the previous steps are successfully performed including Kallisto. Then tracer throws an error that says: Traceback (most recent call last): File "tracer", line 21, in Launcher().launch() File "/scratch/users/zji4@jhu.edu/tracer/tracer/tracerlib/launcher.py", line 54, in launch getattr(self, args.mode)() File "/scratch/users/zji4@jhu.edu/tracer/tracer/tracerlib/launcher.py", line 232, in assemble tpm = counts[locus][rec.contig_name] KeyError: 'TR1|c0_g2_i1'

I checked the "abundance.tsv" file under "expression_quantification" folder in the output folder and the last four lines are: TCR|TR1|c0_g1_i1|TRBV12-1_GCTCTACAACAGGGGGGGCACCG_TRBJ2-2 600 494.667 63.0889 48589 TCR|TR1|c0_g2_i1|TRBV4_AGCTACAACTCCT_TRBJ2-7 592 486.667 371.938 291163 TCR|TR1|c0_g1_i1|TRAV9D-4_GTGAGGGGGAAGGAGAGGCA_TRAJ37 760 654.667 165.336 96215.7 TCR|TR1|c0_g2_i1|TRAV4-2_TTGAGAATAA_TRAJ43 738 632.667 350.764 211221

I was running tracer on CentOS system. I am wondering whether this is actually an error and how I can fix it. Thanks!

[mstubb]

Please can you send me the command you ran along with your configuration file.

Please also zip and send me the IgBLAST_output and Trinity_output subdirectories from the cell1 output directory.

Thanks,

Mike

On 23 Oct 2016, at 23:05, Zhicheng Ji notifications@github.com wrote:

Hi, I am running tracer on the example cell1_1.fastq and cell1_2.fastq that come with the software package. All the previous steps are successfully performed including Kallisto. Then tracer throws an error that says: Traceback (most recent call last): File "tracer", line 21, in Launcher().launch() File "/scratch/users/zji4@jhu.edu/tracer/tracer/tracerlib/launcher.py", line 54, in launch getattr(self, args.mode)() File "/scratch/users/zji4@jhu.edu/tracer/tracer/tracerlib/launcher.py", line 232, in assemble tpm = counts[locus][rec.contig_name] KeyError: 'TR1|c0_g2_i1'

I checked the "abundance.tsv" file under "expression_quantification" folder in the output folder and the last four lines are: TCR|TR1|c0_g1_i1|TRBV12-1_GCTCTACAACAGGGGGGGCACCG_TRBJ2-2 600 494.667 63.0889 48589 TCR|TR1|c0_g2_i1|TRBV4_AGCTACAACTCCT_TRBJ2-7 592 486.667 371.938 291163 TCR|TR1|c0_g1_i1|TRAV9D-4_GTGAGGGGGAAGGAGAGGCA_TRAJ37 760 654.667 165.336 96215.7 TCR|TR1|c0_g2_i1|TRAV4-2_TTGAGAATAA_TRAJ43 738 632.667 350.764 211221

I was running tracer on CentOS system. I am wondering whether this is actually an error and how I can fix it. Thanks!

— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub, or mute the thread.

[zji90]

Hi Mike, Please see attached for the zipped file. run.sh: the command I used to run tracer tracer.conf: the tracer configuration file IgBLAST_output: the output of IgBLAST Trinity_output: the output of Trinity

Thank you very much for your help!

Best, Jason

Zhicheng Ji PhD Student Department of Biostatistics Bloomberg School of Public Health Johns Hopkins University

On Tue, Oct 25, 2016 at 2:51 PM, Mike Stubbington notifications@github.com wrote:

Please can you send me the command you ran along with your configuration file.

Please also zip and send me the IgBLAST_output and Trinity_output subdirectories from the cell1 output directory.

Thanks,

Mike

On 23 Oct 2016, at 23:05, Zhicheng Ji notifications@github.com wrote:

Hi, I am running tracer on the example cell1_1.fastq and cell1_2.fastq that come with the software package. All the previous steps are successfully performed including Kallisto. Then tracer throws an error that says: Traceback (most recent call last): File "tracer", line 21, in Launcher().launch() File "/scratch/users/zji4@jhu.edu/tracer/tracer/tracerlib/launcher.py", line 54, in launch getattr(self, args.mode)() File "/scratch/users/zji4@jhu.edu/tracer/tracer/tracerlib/launcher.py", line 232, in assemble tpm = counts[locus][rec.contig_name] KeyError: 'TR1|c0_g2_i1'

I checked the "abundance.tsv" file under "expression_quantification" folder in the output folder and the last four lines are: TCR|TR1|c0_g1_i1|TRBV12-1_GCTCTACAACAGGGGGGGCACCG_TRBJ2-2 600 494.667 63.0889 48589 TCR|TR1|c0_g2_i1|TRBV4_AGCTACAACTCCT_TRBJ2-7 592 486.667 371.938 291163 TCR|TR1|c0_g1_i1|TRAV9D-4_GTGAGGGGGAAGGAGAGGCA_TRAJ37 760 654.667 165.336 96215.7 TCR|TR1|c0_g2_i1|TRAV4-2_TTGAGAATAA_TRAJ43 738 632.667 350.764 211221

I was running tracer on CentOS system. I am wondering whether this is actually an error and how I can fix it. Thanks!

— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub, or mute the thread.

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/Teichlab/tracer/issues/21#issuecomment-256137777, or mute the thread https://github.com/notifications/unsubscribe-auth/AD0QUn4lijVbGrjvLnjWlkyemrX3zspnks5q3k-dgaJpZM4KeQ57 .

[yotamd]

Hi Mike

I am having a similar issue using tracer 0.5.1. During the test run ('tracer test -c tracer.conf') I get the following error:

Quantifying with Kallisto

[quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 88,202 [index] number of k-mers: 82,099,927 [index] number of equivalence classes: 297,324 [quant] running in paired-end mode [quant] will process pair 1: /seq/epiprod02/old-epigenome01/Shared/software/tracer-0.5.1/test_data/cell1_1.fastq /seq/epiprod02/old-epigenome01/Shared/software/tracer-0.5.1/test_data/cell1_2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 1,135 reads, 1,052

reads pseudoaligned [quant] estimated average fragment length: 106.333 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 36 rounds

Traceback (most recent call last): File "./tracer", line 21, in launch() File "/seq/epiprod02/old-epigenome01/Shared/software/tracer-0.5.1/tracerlib/launcher.py", line 43, in launch Task().run() File "/seq/epiprod02/old-epigenome01/Shared/software/tracer-0.5.1/tracerlib/tasks.py", line 1079, in run loci=['A', 'B'], max_junc_len=50).run() File "/seq/epiprod02/old-epigenome01/Shared/software/tracer-0.5.1/tracerlib/tasks.py", line 324, in run self.quantify(cell) File "/seq/epiprod02/old-epigenome01/Shared/software/tracer-0.5.1/tracerlib/tasks.py", line 530, in quantify tpm = counts[receptor][locus][rec.contig_name] KeyError: 'TR1|c0_g1_i1'

---

Is there any workaround?

Thank you, Yotam

[mstubb]

Hi Yotam,

What version of Trinity are you using? I'm pretty sure that this is due to early versions of Trinity v2 naming their contigs in a way that breaks TraCeR's parser. If you're using something like v2.0.4 then the workaround is to either upgrade to a later version (I've tested with Trinity v2.2.0) or to downgrade to Trinity v1.0.

Hope that helps. If not, please let me know and we can continue troubleshooting.

M

[yotamd]

Yes, that was the issue. Thank you!!

On Fri, May 19, 2017 at 11:40 AM, Mike Stubbington <notifications@github.com

wrote:

Hi Yotam,

What version of Trinity are you using? I'm pretty sure that this is due to early versions of Trinity v2 naming their contigs in a way that breaks TraCeR's parser. If you're using something like v2.0.4 then the workaround is to either upgrade to a later version (I've tested with Trinity v2.4.0) or to downgrade to Trinity v1.0.

Hope that helps. If not, please let me know and we can continue troubleshooting.

M

— You are receiving this because you commented. Reply to this email directly, view it on GitHub https://github.com/Teichlab/tracer/issues/21#issuecomment-302737605, or mute the thread https://github.com/notifications/unsubscribe-auth/AFFfV2O3OEXlYI_nz0QXxCfkMj3NehLdks5r7bgDgaJpZM4KeQ57 .