search

WGLab / doc-ANNOVAR

Documentation for the ANNOVAR software
http://annovar.openbioinformatics.org
234 stars 359 forks source link

base annotation shorter than variant #188

Open asmlgkj opened 2 years ago

asmlgkj commented 2 years ago

Dear professor, Thanks a lot for supplying such a useful tool. I am here want to ask a question. here is a 29 base deletion variant, but the annotation is 25 base, is there any reason for this? thanks a lot chr4 55593578 55593606 ACAGAAACCCATGTATGAAGTACAGTGGA - KIT frameshift deletion KIT:NM_000222.2:exon11:c.1648_1672del:p.K550Rfs*6

kaichop commented 2 years ago

It only delete 25 base pairs in coding sequence (cDNA)

image image

kaichop commented 2 years ago

It only delete 25 base pairs in coding sequence (cDNA)

image image

asmlgkj commented 2 years ago

Thanks a lot, but annotation can also include intron, like c-. if a variant stride across intron and exon, it will only annote the exonic part? and only annote intronic when it is a pure intronic

kaichop commented 2 years ago

This is a variant that essentially creates a frameshift mutation 6 amino acid down the position 550. c_1648_1672 is the correct notation for this mutation, because it tells which coding sequences are deleted by the mutation; but again, what you really should look is the amino acid level change.

On Wed, Apr 20, 2022 at 9:47 AM curry_fan @.***> wrote:

Thanks a lot, but annotation can also include intron, like c-. if a variant stride across intron and exon, it will only annote the exonic part? and only annote intronic when it is a pure intronic

— Reply to this email directly, view it on GitHub https://github.com/WGLab/doc-ANNOVAR/issues/188#issuecomment-1103953629, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABNG3OHGGSJ7BBEQYMJM6DLVGADGXANCNFSM5T37UZBA . You are receiving this because you commented.Message ID: @.***>

asmlgkj commented 2 years ago

thanks a lot, because this is s famous site. P.L550_558del 6981da31b9e28294e8997fe0f807722 I do not know whether should revise to the record in the cosmic

kaichop commented 2 years ago

Public databases may have erroneous or conflicting annotations. For indels, extra caution is needed because it may impact intron/exon boundaries and have unpredictable consequences. If you believe in the 550-558 amino acid deletion, then clearly the c.1648_1674del is wrong. The length does not even match.

On Wed, Apr 20, 2022 at 7:39 PM curry_fan @.***> wrote:

thanks a lot, because this is s famous site. P.L550_558del [image: 6981da31b9e28294e8997fe0f807722] https://user-images.githubusercontent.com/50854682/164341738-62ac819c-afa9-4dd0-b064-8f4f0c79243c.png I do not know whether should revise to the record in the cosmic

— Reply to this email directly, view it on GitHub https://github.com/WGLab/doc-ANNOVAR/issues/188#issuecomment-1104554930, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABNG3OCSHETZGVYHPGUGCBLVGCIRLANCNFSM5T37UZBA . You are receiving this because you commented.Message ID: @.***>

asmlgkj commented 2 years ago

image Thanks a lot. if delete intronic region in annotation, then the variant should move to the 3` end, should annote as c.1649_1673del . thanks a lot also I am here want to confrim that, annovar seems dose not annotate intronic region, just annotate region like exonic, UTR3, UTR5, splicing, unstream. introgenic, am i right?

kaichop commented 2 years ago

annovar can annotate intronic region but it uses a precedence rule. This deletion covers both intron and exon, so it is treated as exonic, not intronic.

On Wed, Apr 20, 2022 at 9:22 PM curry_fan @.***> wrote:

[image: image] https://user-images.githubusercontent.com/50854682/164352061-0fcf3e12-242e-481f-b065-d2cf13c7d184.png Thanks a lot. if delete intronic region in annotation, then the variant should move to the 3` end, should annote as c.1649_1673del . thanks a lot also I am here want to confrim that, annovar seems dose not annotate intronic region, just annotate region like exonic, UTR3, UTR5, splicing, unstream. introgenic, am i right?

— Reply to this email directly, view it on GitHub https://github.com/WGLab/doc-ANNOVAR/issues/188#issuecomment-1104613354, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABNG3OGRB6ZWALKCHENS5FDVGCUWDANCNFSM5T37UZBA . You are receiving this because you commented.Message ID: @.***>

asmlgkj commented 2 years ago

thanks a lot. I found the column are all empty in the AAChange.refGeneWithVer when region is intronic

kaichop commented 2 years ago

intronic variant does not lead to amino acid change

On Wed, Apr 20, 2022 at 10:17 PM curry_fan @.***> wrote:

thanks a lot. I found the column are all empty in the AAChange.refGeneWithVer when region is intronic

— Reply to this email directly, view it on GitHub https://github.com/WGLab/doc-ANNOVAR/issues/188#issuecomment-1104637267, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABNG3OB3M6XKO72KR2GG7FTVGC3CDANCNFSM5T37UZBA . You are receiving this because you commented.Message ID: @.***>