A FASTQ data set downloaded from the SRA (SRP075279) contained extra information on the optional (third) line for each sequence read. This resulted in shapemapper2 failing during the initial ProgressMonitor processes.
shapemapper2 fails with the following error messages:
ERROR: Component "QualityTrimmer" (sample:Modified) failed, giving the following error message:
ERROR: Input file shapemapper_temp/SERPINA1-Shape/Modified/ProgressMonitor/SERPINA1-Shape_Modified_ProgressMonitor_output.fastq does not appear FASTQ formatted.
A quick work around to fix this formatting issue (I only had 3, 90MB fastq files to work with):
sed -i 's/+SRR.*/+/g' file-name.fastq'
A FASTQ data set downloaded from the SRA (SRP075279) contained extra information on the optional (third) line for each sequence read. This resulted in shapemapper2 failing during the initial ProgressMonitor processes.
@SRR3536059.1.2 1 length=95 CTGTAGCGATGCTCACTGGGGAGAAGAAGATATTGGTGCTGTTGGACTGGTGTGCCAGCTGGCGGTATAGGCTGAAGGCGAACTCAGCCAGGTTG +SRR3536059.1.2 1 length=95 CCCBCFFCCCCBGGGGGGGGGGGEFHHHHHHHHHHCGGHHHGHHFHHFGHFGHGHHHGGHHHGGGFCFFHHHFGHHHHHGGGGHHHGGHHHHGHH
shapemapper2 fails with the following error messages: ERROR: Component "QualityTrimmer" (sample:Modified) failed, giving the following error message: ERROR: Input file shapemapper_temp/SERPINA1-Shape/Modified/ProgressMonitor/SERPINA1-Shape_Modified_ProgressMonitor_output.fastq does not appear FASTQ formatted.
A quick work around to fix this formatting issue (I only had 3, 90MB fastq files to work with): sed -i 's/+SRR.*/+/g' file-name.fastq'
Thanks for your help finding the issue Steve.