ecwheele commented 9 years ago

''' INFO 10:46:26,665 QScriptManager - Compiling 1 QScript ERROR 10:46:28,540 QScriptManager - analyze_rna_seq.scala:54: not found: type MapRepetitiveRegions ERROR 10:46:28,558 QScriptManager - case class mapRepetitiveRegions(noAdapterFastq: File, filteredResults: File, filteredFastq: File) extends MapRepetitiveRegions { ERROR 10:46:28,559 QScriptManager - ^ ERROR 10:46:28,580 QScriptManager - analyze_rna_seq.scala:57: value inFastq is not a member of AnalyzeRNASeq.this.mapRepetitiveRegions ERROR 10:46:28,596 QScriptManager - this.inFastq = noAdapterFastq ERROR 10:46:28,596 QScriptManager - ^ ERROR 10:46:28,605 QScriptManager - analyze_rna_seq.scala:58: value outRep is not a member of AnalyzeRNASeq.this.mapRepetitiveRegions ERROR 10:46:28,620 QScriptManager - this.outRep = filteredResults ERROR 10:46:28,621 QScriptManager - ^ ERROR 10:46:28,629 QScriptManager - analyze_rna_seq.scala:59: value outNoRep is not a member of AnalyzeRNASeq.this.mapRepetitiveRegions ERROR 10:46:28,645 QScriptManager - this.outNoRep = filteredFastq ERROR 10:46:28,645 QScriptManager - ^ ERROR 10:46:28,653 QScriptManager - analyze_rna_seq.scala:60: value isIntermediate is not a member of AnalyzeRNASeq.this.mapRepetitiveRegions ERROR 10:46:28,658 QScriptManager - this.isIntermediate = true ERROR 10:46:28,659 QScriptManager - ^ ERROR 10:46:29,342 QScriptManager - analyze_rna_seq.scala:224: too many arguments for constructor FastQC: ()org.broadinstitute.sting.queue.extensions.yeo.FastQC ERROR 10:46:29,342 QScriptManager - add(new FastQC(filteredFastq)) ERROR 10:46:29,343 QScriptManager - ^ ERROR 10:46:29,346 QScriptManager - analyze_rna_seq.scala:227: too many arguments for constructor FastQC: ()org.broadinstitute.sting.queue.extensions.yeo.FastQC ERROR 10:46:29,346 QScriptManager - add(new FastQC(filteredPair)) ERROR 10:46:29,347 QScriptManager - ^ ERROR 10:46:29,556 QScriptManager - analyze_rna_seq.scala:306: too many arguments for constructor FastQC: ()org.broadinstitute.sting.queue.extensions.yeo.FastQC ERROR 10:46:29,557 QScriptManager - add(new FastQC(inFastq = fastqPair)) ERROR 10:46:29,558 QScriptManager - ^ ERROR 10:46:29,559 QScriptManager - analyze_rna_seq.scala:309: too many arguments for constructor FastQC: ()org.broadinstitute.sting.queue.extensions.yeo.FastQC ERROR 10:46:29,560 QScriptManager - add(new FastQC(inFastq = fastqFile)) ERROR 10:46:29,560 QScriptManager - ^ ERROR 10:46:29,686 QScriptManager - analyze_rna_seq.scala:294: type mismatch; found : ((AnalyzeRNASeq.this.File, String, String)) => Unit required: ((java.io.File, String, String, String, String, String)) => ? ERROR 10:46:29,686 QScriptManager - for (item: Tuple3[File, String, String] <- valueList) { ERROR 10:46:29,687 QScriptManager - ^ ERROR 10:46:30,150 QScriptManager - 10 errors found '''

gpratt commented 9 years ago

You're using an out of date version of gscripts. git pull and update.

Gabriel Pratt Bioinformatics Graduate Student, Yeo Lab University of California San Diego

On Fri, Jul 24, 2015 at 10:48 AM, ecwheele notifications@github.com wrote:

''' INFO 10:46:26,665 QScriptManager - Compiling 1 QScript ERROR 10:46:28,540 QScriptManager - analyze_rna_seq.scala:54: not found: type MapRepetitiveRegions ERROR 10:46:28,558 QScriptManager - case class mapRepetitiveRegions(noAdapterFastq: File, filteredResults: File, filteredFastq: File) extends MapRepetitiveRegions { ERROR 10:46:28,559 QScriptManager - ^ ERROR 10:46:28,580 QScriptManager - analyze_rna_seq.scala:57: value inFastq is not a member of AnalyzeRNASeq.this.mapRepetitiveRegions ERROR 10:46:28,596 QScriptManager - this.inFastq = noAdapterFastq ERROR 10:46:28,596 QScriptManager - ^ ERROR 10:46:28,605 QScriptManager - analyze_rna_seq.scala:58: value outRep is not a member of AnalyzeRNASeq.this.mapRepetitiveRegions ERROR 10:46:28,620 QScriptManager - this.outRep = filteredResults ERROR 10:46:28,621 QScriptManager - ^ ERROR 10:46:28,629 QScriptManager - analyze_rna_seq.scala:59: value outNoRep is not a member of AnalyzeRNASeq.this.mapRepetitiveRegions ERROR 10:46:28,645 QScriptManager - this.outNoRep = filteredFastq ERROR 10:46:28,645 QScriptManager - ^ ERROR 10:46:28,653 QScriptManager - analyze_rna_seq.scala:60: value isIntermediate is not a member of AnalyzeRNASeq.this.mapRepetitiveRegions ERROR 10:46:28,658 QScriptManager - this.isIntermediate = true ERROR 10:46:28,659 QScriptManager - ^ ERROR 10:46:29,342 QScriptManager - analyze_rna_seq.scala:224: too many arguments for constructor FastQC: ()org.broadinstitute.sting.queue.extensions.yeo.FastQC ERROR 10:46:29,342 QScriptManager - add(new FastQC(filteredFastq)) ERROR 10:46:29,343 QScriptManager - ^ ERROR 10:46:29,346 QScriptManager - analyze_rna_seq.scala:227: too many arguments for constructor FastQC: ()org.broadinstitute.sting.queue.extensions.yeo.FastQC ERROR 10:46:29,346 QScriptManager - add(new FastQC(filteredPair)) ERROR 10:46:29,347 QScriptManager - ^ ERROR 10:46:29,556 QScriptManager - analyze_rna_seq.scala:306: too many arguments for constructor FastQC: ()org.broadinstitute.sting.queue.extensions.yeo.FastQC ERROR 10:46:29,557 QScriptManager - add(new FastQC(inFastq = fastqPair)) ERROR 10:46:29,558 QScriptManager - ^ ERROR 10:46:29,559 QScriptManager - analyze_rna_seq.scala:309: too many arguments for constructor FastQC: ()org.broadinstitute.sting.queue.extensions.yeo.FastQC ERROR 10:46:29,560 QScriptManager - add(new FastQC(inFastq = fastqFile)) ERROR 10:46:29,560 QScriptManager - ^ ERROR 10:46:29,686 QScriptManager - analyze_rna_seq.scala:294: type mismatch; found : ((AnalyzeRNASeq.this.File, String, String)) => Unit required: ((java.io.File, String, String, String, String, String)) => ? ERROR 10:46:29,686 QScriptManager - for (item: Tuple3[File, String, String] <- valueList) { ERROR 10:46:29,687 QScriptManager - ^ ERROR 10:46:30,150 QScriptManager - 10 errors found '''

— Reply to this email directly or view it on GitHub https://github.com/YeoLab/gscripts/issues/77.

ecwheele commented 9 years ago

I just did that and still got this error message

gpratt commented 9 years ago

Where is your gatk queue jar?

Gabriel Pratt Bioinformatics Graduate Student, Yeo Lab University of California San Diego

On Fri, Jul 24, 2015 at 10:50 AM, ecwheele notifications@github.com wrote:

I just did that and still got this error message

— Reply to this email directly or view it on GitHub https://github.com/YeoLab/gscripts/issues/77#issuecomment-124597943.

olgabot commented 9 years ago

Can you post your sh script, manifest, and error log as a gist, like this? https://gist.github.com/olgabot/160c649786d45920ed09

On Fri, Jul 24, 2015 at 10:50 AM ecwheele notifications@github.com wrote:

I just did that and still got this error message

— Reply to this email directly or view it on GitHub https://github.com/YeoLab/gscripts/issues/77#issuecomment-124597943.

ecwheele commented 9 years ago

I don't know how to post as a gist but here are my files.

sh script:

!/bin/bash

NAME=linlab_SRSF2 VERSION=v1

DIR=pipeline

java -Xms512m -Xmx512m -jar /home/yeo-lab/software/gatk/dist/Queue.jar -S ~/gscripts/qscripts/analyze_rnaseq.scala --input manifest.txt --adapter TCGTATGCCGTCTTCTGCTTG --adapter ATCTCGTATGCCGTCTTCTGCTTG --adapter CGACAGGTTCAGAGTTCTACAGTCCGACGATC --adapter GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -qsub -jobQueue home-yeo -log ${NAME}${VERSION}.log --location /oasis/tscc/scratch/ecwheele/linlab_SRSF2/ --strict -keepIntermediates --flipped flip -run

manifest: 5770_TF1_TetON_TTAGGC_L078_R1_001.fastq.gz;5770_TF1_TetON_TTAGGC_L078_R2_001.fastq.gz hg19 5771_SRSF2_WT_GCCAAT_L078_R1_001.fastq.gz;5771_SRSF2_WT_GCCAAT_L078_R2_001.fastq.gz hg19 5772_SRSF2_H_CTTGTA_L078_R1_001.fastq.gz;5772_SRSF2_H_CTTGTA_L078_R2_001.fastq.gz hg19 5773_SRSF2_L_AGTTCC_L078_R1_001.fastq.gz;5773_SRSF2_L_AGTTCC_L078_R2_001.fastq.gz hg19 5774_SRSF2_R_CGATGT_L078_R1_001.fastq.gz;5774_SRSF2_R_CGATGT_L078_R2_001.fastq.gz hg19 P95H_S6485_L012_R1_001.fastq.gz;P95H_S6485_L012_R2_001.fastq.gz hg19 P95L_S6486_L012_R1_001.fastq.gz;P95L_S6486_L012_R2_001.fastq.gz hg19 P95R_S6487_L012_R1_001.fastq.gz;P95R_S6487_L012_R2_001.fastq.gz hg19 TetON_S6483_L012_R1_001.fastq.gz;TetON_S6483_L012_R2_001.fastq.gz hg19 WT_S6484_L012_R1_001.fastq.gz;WT_S6484_L012_R2_001.fastq.gz hg19

and my error message is above

ecwheele commented 9 years ago

the command which gatk queue jar returns with nothing found

olgabot commented 9 years ago

posting a gist is pasting text into a text box: https://gist.github.com/

it's much easier to read code when it's in monospace than regular font - it's what I'm used to.

On Fri, Jul 24, 2015 at 10:58 AM ecwheele notifications@github.com wrote:

I don't know how to post as a gist but here are my files.

sh script:

!/bin/bash

NAME=linlab_SRSF2 VERSION=v1

DIR=pipeline

java -Xms512m -Xmx512m -jar /home/yeo-lab/software/gatk/dist/Queue.jar -S ~/gscripts/qscripts/analyze_rnaseq.scala --input manifest.txt --adapter TCGTATGCCGTCTTCTGCTTG --adapter ATCTCGTATGCCGTCTTCTGCTTG --adapter CGACAGGTTCAGAGTTCTACAGTCCGACGATC --adapter GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -qsub -jobQueue home-yeo -log ${NAME}${VERSION}.log --location /oasis/tscc/scratch/ecwheele/linlab_SRSF2/ --strict -keepIntermediates --flipped flip -run

manifest: 5770_TF1_TetON_TTAGGC_L078_R1_001.fastq.gz;5770_TF1_TetON_TTAGGC_L078_R2_001.fastq.gz hg19 5771_SRSF2_WT_GCCAAT_L078_R1_001.fastq.gz;5771_SRSF2_WT_GCCAAT_L078_R2_001.fastq.gz hg19 5772_SRSF2_H_CTTGTA_L078_R1_001.fastq.gz;5772_SRSF2_H_CTTGTA_L078_R2_001.fastq.gz hg19 5773_SRSF2_L_AGTTCC_L078_R1_001.fastq.gz;5773_SRSF2_L_AGTTCC_L078_R2_001.fastq.gz hg19 5774_SRSF2_R_CGATGT_L078_R1_001.fastq.gz;5774_SRSF2_R_CGATGT_L078_R2_001.fastq.gz hg19 P95H_S6485_L012_R1_001.fastq.gz;P95H_S6485_L012_R2_001.fastq.gz hg19 P95L_S6486_L012_R1_001.fastq.gz;P95L_S6486_L012_R2_001.fastq.gz hg19 P95R_S6487_L012_R1_001.fastq.gz;P95R_S6487_L012_R2_001.fastq.gz hg19 TetON_S6483_L012_R1_001.fastq.gz;TetON_S6483_L012_R2_001.fastq.gz hg19 WT_S6484_L012_R1_001.fastq.gz;WT_S6484_L012_R2_001.fastq.gz hg19

and my error message is above

— Reply to this email directly or view it on GitHub https://github.com/YeoLab/gscripts/issues/77#issuecomment-124599935.

olgabot commented 9 years ago

Do you get an error from just running the java GATK queue?

$ java -Xms512m -Xmx512m -jar /home/yeo-lab/software/gatk/dist/Queue.jar
----------------------------------------------------------------------
Queue v2.3-1155-g931452b, Compiled 2015/07/02 11:50:06
Copyright (c) 2012 The Broad Institute
For support and documentation go to http://www.broadinstitute.org/gatk
----------------------------------------------------------------------
----------------------------------------------------------------------
[truncated ....]
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR stack trace 
org.broadinstitute.sting.commandline.MissingArgumentException: 
Argument with name '--script' (-S) is missing.
        at org.broadinstitute.sting.commandline.ParsingEngine.validate(ParsingEngine.java:296)
        at org.broadinstitute.sting.commandline.ParsingEngine.validate(ParsingEngine.java:276)
        at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:213)
        at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
        at org.broadinstitute.sting.queue.QCommandLine$.main(QCommandLine.scala:62)
        at org.broadinstitute.sting.queue.QCommandLine.main(QCommandLine.scala)
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR A GATK RUNTIME ERROR has occurred (version 2.3-1155-g931452b):
##### ERROR
##### ERROR Please check the documentation guide to see if this is a known problem
##### ERROR If not, please post the error, with stack trace, to the GATK forum
##### ERROR Visit our website and forum for extensive documentation and answers to 
##### ERROR commonly asked questions http://www.broadinstitute.org/gatk
##### ERROR
##### ERROR MESSAGE: Argument with name '--script' (-S) is missing.
##### ERROR ------------------------------------------------------------------------------------------
INFO  11:00:03,193 QCommandLine - Shutting down jobs. Please wait...

olgabot commented 9 years ago

that's the expected error since there's no script, but that's what the output you should see when running that

ecwheele commented 9 years ago

yes I get an error when just running the java GATK queue

https://gist.github.com/ecwheele/7f655e9448519934d840

olgabot commented 9 years ago

The "error" is because there is no script - that is expected.

From your manifest, one probllem I see is that the paths for the fastqs are not absolute - they need to have the full path aka all the folders leading up to the fastq. that wont' fix the GATK Queue problem but it's something you'll run into later.

What is the first few lines of git log ?

Mine says:

commit affbed2982412a673d7e0ba26bc195b3f1087456
Merge: 4fcecce 32425c0
Author: Olga Botvinnik <olga.botvinnik@gmail.com>
Date:   Mon Jul 6 12:16:55 2015 -0700

    Merge branch 'master' of github.com:YeoLab/gscripts

    * 'master' of github.com:YeoLab/gscripts: (29 commits)
      updated script so makebigwig file would work (revert broke it)
      fixed sort_fastq to use a temp file, which will prevent issues when running stuff in parallel
      changed gapped alignments to be properly split during QC
      updated rna seq and clip seq analysis sciprts to work with the new fastq file
      fixed bugs in make bigwig files
      added sort_fastq script to prevent pe sorting issues
      added explicit naming of outout files
      added better error message if read names don't match
      added hamming distance qc for demuxing qc
      many pipeline updates to analyze clipseq
      turned make bigwig files into proper script
      first commit of bigwig generator wrapper
      forgot comma
      adding paired end barcode collapsing to the repo
      adding paired end barcode collapsing to the repo
      a few more naming updates
      a few more naming updates
      standardizing names between old and new versions
      fixed a number of additional bugs in cutadapt parser
      fixed parse_cutadapt to work with cutadapt 1.8 and 1.9 gracefully in my parsers
      ...

which means this is probably my fault. I'll look into it

olgabot commented 9 years ago

Okay I just updated it and this command runs:

java -Xms512m -Xmx512m -jar /home/yeo-lab/software/gatk/dist/Queue.jar -S ~/gscripts/qscripts/analyze_rna_seq.scala --input manifest.txt --adapter TCGTATGCCGTCTTCTGCTTG --adapter ATCTCGTATGCCGTCTTCTGCTTG --adapter CGACAGGTTCAGAGTTCTACAGTCCGACGATC --adapter GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -qsub -jobQueue home-yeo -log ${NAME}_${VERSION}.log --location /oasis/tscc/scratch/ecwheele/linlab_SRSF2/ --strict -keepIntermediates --flipped flip -run

With an expected error, sicne I don't ahve a manifest.txt file. If this is the error you're getting, then double-check the location of the manifest.txt file and that it's in the same directory that you're runnig the script from

org.broadinstitute.sting.utils.exceptions.UserException$CannotExecuteQScript: Unable to execute QScript: AnalyzeRNASeq.script() threw the following exception: java.io.FileNotFoundException: manifest.txt (No such file or directory)

olgabot commented 9 years ago

Do a git pull and make sure the most recent thing in git log is:

[obotvinnik@tscc-login2 gscripts]$ git log
commit 32425c0cc7395a9e83cf1916e1217cc27a44bc10
Author: Gabriel Pratt <gpratt@ucsd.edu>
Date:   Fri Jul 3 11:59:59 2015 -0700

    updated script so makebigwig file would work (revert broke it)

ecwheele commented 9 years ago

There was a problem with my earlier git pull. It is running now. Thank you for your help!!!

olgabot commented 9 years ago

yay it works!

YeoLab / gscripts

analyze_rna_seq.scala won't work #77

!/bin/bash

DIR=pipeline

!/bin/bash

DIR=pipeline