search

aakechin / NGS-PrimerPlex

NGS-PrimerPlex is a high-throughput tool for mupltiplex primer design
GNU General Public License v3.0
54 stars 21 forks source link

primers_combination_1_info.xls chromosome coordinate inconformity #50

Closed kr1stoff closed 1 year ago

kr1stoff commented 1 year ago

Hi, @aakechin First of all, thank you for the tools!

I had a Problem when designing the primers, one row(name Exophiala dermatitidis-3-31 in region bed) of primers_combination_1_info.xls Amplicon_Start and Amplicon_End coordinate system is different from the other rows. Other rows like 1-based coordinate system, i use samtools faidx Chrom:Amplicon_Start-Amplicon_End query region, the sequence is consistent with Left_Primer_Seq and Right_Primer_Seq. but "Exophiala dermatitidis-3-31" not. the primers_combination_1_info.xls Chrom,Amplicon_Start,Amplicon_End is "NW_008751655.1,113,312". in practice, real coordinate is "NW_008751655.1,114,313" by samtools faidx manual check. WHY??

Command line

python3.8 NGS-PrimerPlex-1.3.3/NGS_primerplex.py -ref Exophiala-dermatitidis-5970/5970/ref.fna -region design/2tNGS.bed -th 100 -primernum1 10 -blast -minampllen 175 -maxampllen 250 -optampllen 200 -minprimerlen 18 -maxprimerlen 28 -optprimerlen 23 -minprimermelt 63 -maxprimermelt 67 -optprimermelt 64 -minprimergc 30 -maxprimergc 70 -optprimergc 50 -minprimerendgc 0 -maxprimerendgc 5 -maxprimerpolyn 5  -maxoverlap 300 -returnvariantsnum 5 -skip

REF is Exophiala dermatitidis reference genome sequence, BED as follow

...
NW_008751655.1  212     286     Exophiala dermatitidis-3-1      1       B       W
NW_008751655.1  212     287     Exophiala dermatitidis-3-11     1       B       W
NW_008751655.1  212     289     Exophiala dermatitidis-3-21     1       B       W
NW_008751655.1  201     286     Exophiala dermatitidis-3-31     1       B       W
...

primers_combination_1_info.xls

#   Left_Primer_Seq Right_Primer_Seq    Amplicon_Name   Chrom   Amplicon_Start  Amplicon_End
...
61  GTTCTGTGCATTACCAACGTGAC CTGTCGACCTGGGATTTGAGAAT Exophiala dermatitidis-3-31 NW_008751655.1  113 312
62  GCATTGCAGCCATGAACGGA    CACTCAGACCCACCAGCAAG    Exophiala dermatitidis-2-46 NW_008751655.1  269 468
63  GAGATGTCGTTGTCTGGATTATGTTG  GCCAGCCAACCCTGAACT  Exophiala dermatitidis-2-10 NW_008751655.1  346 546
64  TTCTTCCTCCAGCAGTTGTTTCA ACAATGCCCCGTTTGCTGT Exophiala dermatitidis-8-45 NW_008751655.1  2658    2857
...

Looking forward to your reply!

aakechin commented 1 year ago

@kr1stoff Thank you very much for your issue report. There was really a mistake for primers that start near the start of the reference sequence. Increase by one was absent there. The updated version is available now. Thank you!

kr1stoff commented 1 year ago

Well, i ran the script again and it looks fixed. thanks!