aaranyue / quarTeT

A telomere-to-telomere toolkit for gap-free genome assembly and centromeric repeat identification
http://atcgn.com:8080/quarTeT/home.html
101 stars 7 forks source link

Centrominer candidate file fields meaning #34

Open V-JJ opened 6 months ago

V-JJ commented 6 months ago

Hello!

I'm trying to understand the meaning of Centrominer output *candidate.tsv files. Here is a small example of our results.

# Chr   start   end length  TRlength    TRcoverage
#   subTR   period  subTRlength subTRcoverage   pattern
ctg82   2242095 2393236 151142  6577    4.35%
    ctg82@TR_00121  149 1534        TGTATTAGTGTTATCTTTTATAGAAAATT
    ctg82@TR_00099  141 1275    0.84%   AGTACGACTCAACCTTATTTTCTGTATTAGTGCTAT

I would like to ask you to explain the fields and numbers meaning in detail Thanks in advance,

Vadim