search

adnaniazi / tailfindr

An R package for estimating poly(A)-tail lengths in Oxford Nanopore RNA and DNA reads.
https://www.cbu.uib.no/valen/
GNU General Public License v3.0
48 stars 15 forks source link

DNA primer #70

Open guangzhaocs opened 1 month ago

guangzhaocs commented 1 month ago

Hi, I use your data (dna_rep1_sqklsk108_flipflop, dna_rep2_sqklsk109_flipflop) to test the ployA/ployT for DNA. But I am confued whta is the correct end_primer and front_primer.

In your paper Table 5(https://rnajournal.cshlp.org/content/25/10/1229/T5.expansion.html), there are PCR primer and Nanopore primer. I tried both but failed to get the results.

And now here is my code, and I get partical resluts:

df <- find_tails(fast5_dir = 'fast5',
                 save_dir = 'tailfindr',
                 basecall_group = 'Basecall_1D_001',
                 csv_filename = 'dna_tails.csv',
                 num_cores = 20,
                 dna_datatype = 'custom-cdna',
                 front_primer = "ATTTAGGTGACACTATAGCGCTCCATGCAAACCTGTC",
                 end_primer   = "GAGTCCGGGCGGCGC")

image

Thanks a lot

adnaniazi commented 1 month ago

Hi,

Try installing the oldest version of tailfindr from the link below:

https://github.com/adnaniazi/tailfindr/tags

The latest version no longer supports older original data. Also do not use front and end primer arguments in your command