search

akdess / BAFExtract

5 stars 5 forks source link

Could not find 1_allele_counts.bin.gz #3

Closed SJRussell closed 4 years ago

SJRussell commented 5 years ago

Hi there. I am trying to generate BAF files and encountering the error: Could not find test/1_allele_counts.bin.gz. After using the command: samtools view 14T.bam | ~stewart/BAFExtract/bin/BAFExtract -generate_compressed_pileup_per_SAM stdin ../hg38.list test 50 0; ~stewart/BAFExtract/bin/BAFExtract -get_SNVs_per_pileup ../hg38.list test ../hg38/ 20 4 0.1 14_test.baf

This is my directory stucture: find.txt

Thanks in advance

akdess commented 4 years ago

Hi, Can you try running the below command by giving the full paths for the files?

samtools view 14T.bam | ~stewart/BAFExtract/bin/BAFExtract -generate_compressed_pileup_per_SAM stdin ../hg38.list test 50 0;

SJRussell commented 4 years ago

For sure. See below: $ samtools view 14T.bam | ~stewart/BAFExtract/bin/BAFExtract -generate_compressed_pileup_per_SAM stdin ../CaSpER/hg38.list test 50 0;

Generating pileup from SAM file with min mapp qual 50, min base qual 0
Dumping the pileups per SAM file stdin
Allocating pileup memory.
Done.
Maximum # of alleles at each position: 65536
Phred+33 encoding @ 0. read (6):
AGTTTAACCAAGAAAAGAAGAGAGAAAATCCAAATAACCTCACTAAGAAATGAAACAGGGGATATTACAACTGACACCACTGAAATATTAAAGATTATTCAAGGG
A6EEEEEE6EEE/EEEEEEE/E//A6EEEEEEEEEEEE<EAAE//EE/EEEE/EEAEE/AE6EA/EEE/EE///EEEAEAE<///EAA//EAA/AE<EEE/E/EE
Segmentation fault (core dumped)

Any ideas why there is a seg fault?

AmandaKedaigle commented 4 years ago

Hi! Has this been solved? I am getting this same seg fault (after giving it quite a bit of memory to play with). It doesn't happen with the test bam, so it must be something about my bam file, but I cannot think of what it could be.

AmandaKedaigle commented 4 years ago

(one hour later) in my case, I was giving it the wrong chr length .list file (hg38 instead of hg19) - it is running now!

ozgunharmanci commented 4 years ago

Hi, thank you for updating with the solution to the issue. We will update the code to make sure that it does not segfault with incorrect reference genome in the arguments.

jgarces02 commented 2 years ago

Hi, I'm having the same issue. In that case, with the correct reference and requesting a huge amount of RAM...