search

akiomiyao / tif

Transposon Insertion Finder - Detection of new TE insertions in NGS data
19 stars 4 forks source link

Does TIF work well for non-LTRs ? #1

Closed HounerX closed 4 years ago

HounerX commented 4 years ago

Hello, I have been trying to use TIF for a non-LTR in drosophila. I am having hard time deciding how many bp i should include in the 5' and 3' ? Also it is important to note that the 3' has a poly(A) should i include that ?

I tried multiple stuff and no luck with getting an output. Do you have any advice please ?

Thank you so much

akiomiyao commented 4 years ago

Hi, Currently, TIF is not supported for non-LTR retrotransposons. If you know accession numbers of NGS containing sequences of jumped non-LTR retrotransposons, let me know accession numbers. I will add scripts for non-LTR retrotransposons. Thank you for your comment, Akio

HounerX commented 4 years ago

Thank you so much for responding.

Here are the accession numbers. They should all have insertions of non-LTRs. DGRP.names.list.txt

The non-LTR we are interested in is Jockey-3. Here is the consensus sequence if that would help

jockey-3_DM_Consensus_06052020.txt

Thank you so much.

akiomiyao commented 4 years ago

Hi,

Initial version of tif_nonltr.pl is now registered.

Usage is perl tif_nonltr.pl SRR834538 dmel626.fasta GAACCCTCTGTCGTAGAACACTACTA

I attempted to detect the transposition from some accessions of your list. But I can not detect transposition. If you know accession with transposition of jockey-3, try the accession first.

Akio

HounerX commented 4 years ago

Hello thank you so much. I have reran the program on accession numbers and I got output written in the result. like that for example image

Does this indicate the insertion site in the reference genome ? what is the difference between labaling head and tail ?

I did check at the coordinates within a window and it looks similar to TSD we see

Thank you so much

akiomiyao commented 4 years ago

Hi,

Because downstream flanking sequence of non-LTR-retrotransposons may have unclear TSD, tif_nonltr.pl detect junction within 100bp distance between junctions of head and polyA tail of the retrotransposon. The transposon may be inserted in the Y_Contig26.

Akio

HounerX commented 4 years ago

oh thank you so much for all the help, so can i interpret that between these coordinates a might be a possible target insertion ?

akiomiyao commented 4 years ago

Yes, may be.

If fragment is obtained by PCR with primers between the target region and the transposon, the transposon should be inserted at the target region.

Akio

HounerX commented 4 years ago

Thank you so much for all the help. I really appreciate it. This helped us.