Open nicholasschwab opened 1 year ago
Hi @nicholasschwab
Which protocol is this sample and which chemistry?
It is supposed to be a 10x genomics 5' (with BCR sequences in a separate fastq file) and the authors do not specify which chemistry. However, I have previously successfully converted V3 chemistry with STAR solo and, therefore, I don't think it's V3. I have tried to adjust for V2 with other UMI length, but to no avail.
A read looks like this (if that helps):
gnl|SRA|SRR12483421.1.3A00351:91:HGNMFDSXX:1:1101:10004:10207 Biological (Biological) GTTGACAAAGAAAAACAAGGCATCCTCAGCTCGGAGATGAATTCGCTTCCGGATCAAGAAGTAGAACTGACCAACTGTGAGATCAGAAGGCACCAGGTATTTCTTTTTGTCCAGGTCTCCTATCCGAGCTTTGGGAGCCTTTTCTACTAT
Since they have CB/UMI read separate from cDNA reads, I would try to treat them as if they were 3' v2, i.e.
--readFilesIn read_150b read_26b
--soloCBstart 1 --soloCBlen 16 --soloUMIstart 17 --soloUMIlen 10
without --soloBarcodeMate 1
You may need to try both --soloStrand Forward
and --soloStrand Reverse
to get the right strandedness.
Also, you may need to try different passlists.
Hello everyone,
I cannot figure out where I go wrong, but I get no mapped reads from 10x fastq files that I downloaded from SRA.
example:
https://www.ncbi.nlm.nih.gov/sra/SRX8976950
I used this STAR command, which has worked in the past for 10x 5', but maybe there is a problem with the chemistry version that I do not see?
Thanks for any help!
STAR --soloBarcodeMate 1 --clip5pNbases 39 0 --soloStrand Forward --soloType CB_UMI_Simple --soloCBwhitelist /STAR/counts/737K-august-2016.txt --soloCBstart 1 --soloCBlen 16 --soloUMIstart 17 --soloUMIlen 12 --soloUMIdedup 1MM_CR --soloCBmatchWLtype 1MM_multi_Nbase_pseudocounts --soloUMIfiltering MultiGeneUMI_CR --soloCellFilter EmptyDrops_CR --outFilterScoreMin 30 --soloFeatures Gene GeneFull Velocyto --soloOutFileNames test/ genes.tsv barcodes.tsv matrix.mtx --genomeDir /STAR/counts/STARgenome --runThreadN 56 --readFilesIn fastq_R1 fastq_R2 --soloMultiMappers EM --outReadsUnmapped Fastx