remove adaptor sequence

[GoogleCodeExporter]

Hi there, 
i run the cutadapt to remove adaptor sequence from RNA-SEQ data, but it gave me 
some error. could you please help me fix it? Thanks. 
Below is the error,

'import site' failed; use -v for traceback
Traceback (most recent call last):
  File "/opt/bioinf/bin/cutadapt", line 71, in <module>
    _libdir = join(dirname(realpath(__file__)), 'lib')
  File "/usr/lib64/python2.6/posixpath.py", line 362, in realpath
    if islink(component):
  File "/usr/lib64/python2.6/posixpath.py", line 135, in islink
    return stat.S_ISLNK(st.st_mode)
AttributeError: 'module' object has no attribute 'S_ISLNK'

Original issue reported on code.google.com by xinhui...@gmail.com on 18 Jan 2012 at 4:50

[GoogleCodeExporter]

Which command line did you run cutadapt with? Which operating system are you on?

Please run this on the command line:

python -c 'import os; print os.path.islink("/")'

It should simply print "False". If you get an error, is it the same as the one 
above?

Original comment by marcel.m...@tu-dortmund.de on 19 Jan 2012 at 2:21

[GoogleCodeExporter]

Thanks for reply.
The command I run the cutadapt is, 
cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCG Sample.fastq > 
 Sample_cut.fastq
The operating system is linux.
I also run the command line you mentioned, python -c 'import os; print 
os.path.islink("/")'
It shows the error, 
'import site' failed; use -v for traceback
Traceback (most recent call last):
  File "<string>", line 1, in ?
  File "/usr/lib64/python2.4/posixpath.py", line 162, in islink
    return stat.S_ISLNK(st.st_mode)
AttributeError: 'module' object has no attribute 'S_ISLNK'

Could you please let me know which command I should run to cut the adaptor from 
RNA-SEQ data?
Thanks.

Original comment by reneex...@gmail.com on 19 Jan 2012 at 8:30

[GoogleCodeExporter]

There seems to be a problem with your installation. Please run this:

python -c 'import stat; print stat.__file__'

This should say something like /usr/lib64/python2.4/stat.py.

Have you modified your PYTHONPATH environment variable?

Original comment by marcel.m...@tu-dortmund.de on 20 Jan 2012 at 11:16

[GoogleCodeExporter]

Thanks for your help.

When i run python -c 'import stat; print stat.__file__',
It says, 'import site' failed; use -v for traceback
/opt/bioinf/cistematic/3.0/stat/__init__.pyc

Do you how can I modify the PYTHONPATH environment variable?
Thanks,

Original comment by reneex...@gmail.com on 20 Jan 2012 at 6:20

[GoogleCodeExporter]

Ok, for some reasen, the module 'stat' from the cistematic package is being 
found instead of the 'stat' module that comes with Python. This isn't a 
cutadapt bug: It seems the cistematic package was installed incorrectly since 
it hides Python system modules. Do you have a system administrator you could 
ask about this? I'd ready to help a bit more, but I'd suggest to continue via 
e-mail.

You can print your PYTHONPATH environment variable with:
echo $PYTHONPATH

Interesting would also be this:
python -c 'import sys; print sys.path'

Original comment by marcel.m...@tu-dortmund.de on 20 Jan 2012 at 6:39

[GoogleCodeExporter]

I hope you were able to fix the problem. Since there weren’t any further 
messages regarding this problem and the problem was not with cutadapt, I’m 
closing this bug report. 

Original comment by marcel.m...@tu-dortmund.de on 9 Mar 2012 at 10:17

• Changed state: Invalid