-g finds and deletes adapter from end of read

[GoogleCodeExporter]

What steps will reproduce the problem?
1.sequence is 
TTGGCCAATTGGCCAATGACTGTGATGCTGTAGTCGTGATGCTGATGCTGTAGCTAGCTGTAGTGTGTCGATGACTGAAC
CGGTTAACCGGTT
2. Adapter is AACCGGTTAACCGGTT
3. using -g

What is the expected output? What do you see instead?
The adapater should not be found since it is at the end of the read

What version of the product are you using? On what operating system?
1.0

Please provide any additional information below.
Returns empty sequence. According to the documentation, the -g option only 
looks for hits at the beginning of a sequence

Original issue reported on code.google.com by apt.univ...@gmail.com on 2 Jun 2012 at 7:45

[GoogleCodeExporter]

Please see also issue 36. The -g option searches for adapters anywhere within 
the read. The difference to the -a option is simply that it removes everything 
before the adapter. To get the behavior you want, you need to add the character 
"^" to the beginning of your adapter sequence, which will 'anchor' the adaptor 
(it will then be found only if it is a prefix of the read).

This feature will be available in the soon to be released cutadapt 1.1, or you 
can get the program from github here: https://github.com/marcelm/cutadapt .

Original comment by marcel.m...@tu-dortmund.de on 17 Jun 2012 at 6:09

• Changed state: Fixed