bolosky
commented
5 years ago The FASTQ link isn’t a link, could you please resend it?
--Bill
From: sjlgg notifications@github.com Sent: Tuesday, October 22, 2019 4:30 AM To: amplab/snap snap@noreply.github.com Cc: Subscribed subscribed@noreply.github.com Subject: [amplab/snap] Occur Segmentation fault (core dumped) problem (#123)
i run the software like following:
`snap-aligner index CP009072.1.fasta ./CP009072_index Welcome to SNAP version 1.0beta.24.
Hash table slack 0.300000 Loading FASTA file 'CP009072.1.fasta' into memory... FASTA file contained a character that's not a valid base (or N): 'Y', full line 'TGCGGCCCCGGAAAATGAAAACATGGCCGGACATGGGATCGTCTTTCAGCGCCGTYTGTACTTTCGCAGC'; converting to 'N'. This may happen again, but there will be no more warnings. 0s Saving genome...0s Computing bias table. Computed bias table in 0s Allocating memory for hash tables...0s Building hash tables. 53749(1%) seeds occur more than once, total of 132985(2%) genome locations are not unique, 764(0%) bad seeds, 0 both complements used 500 no string Hash table build took 0s Building overflow table. Overflow table build and hash table save took 0s Saving overflow table...0s Index build and save took 0s (5131767 bases/s)`
after build index: `snap-aligner single CP009072_index/ SRR2061818.fastq -o alignment_CP009072_result.sam Welcome to SNAP version 1.0beta.24.
Loading index from directory... 0s. 5131767 bases, seed size 20 Aligning. Segmentation fault (core dumped)`
i dont know why the error happen. could someone help me? CP009072.1.fasta download from herehttps://nam06.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.ebi.ac.uk%2Fena%2Fdata%2Fview%2FCP009072%26display%3Dfasta%26download%3Dfasta%26filename%3DCP009072.fasta&data=02%7C01%7Cbolosky%40microsoft.com%7C1380e8bb50964d32ca7c08d756e32b1d%7C72f988bf86f141af91ab2d7cd011db47%7C1%7C0%7C637073405986340899&sdata=Q8fXrXXYhk6ILxyOHJ3zgpRA73BbMzQZdpGonZhAKX0%3D&reserved=0 SRR2061818.fastq download from here
— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHubhttps://nam06.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Famplab%2Fsnap%2Fissues%2F123%3Femail_source%3Dnotifications%26email_token%3DAAHPTWJHPNZQGWJ6ZDNFF3LQP3P3LA5CNFSM4JDOJ2N2YY3PNVWWK3TUL52HS4DFUVEXG43VMWVGG33NNVSW45C7NFSM4HTPBJJQ&data=02%7C01%7Cbolosky%40microsoft.com%7C1380e8bb50964d32ca7c08d756e32b1d%7C72f988bf86f141af91ab2d7cd011db47%7C1%7C0%7C637073405986350903&sdata=cNFV3MMc37sX2unUg5ZwDAD6RgkX%2B7oPtQ4aXD5eV2c%3D&reserved=0, or unsubscribehttps://nam06.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fnotifications%2Funsubscribe-auth%2FAAHPTWKGIP3W5SJIX6WVPSDQP3P3LANCNFSM4JDOJ2NQ&data=02%7C01%7Cbolosky%40microsoft.com%7C1380e8bb50964d32ca7c08d756e32b1d%7C72f988bf86f141af91ab2d7cd011db47%7C1%7C0%7C637073405986350903&sdata=a5XwGv3lAFDx5TuOSmPjcu6eFSo8tfRKeyFqi7IqDCw%3D&reserved=0.
sjlgg
i run the software like following:
`snap-aligner index CP009072.1.fasta ./CP009072_index Welcome to SNAP version 1.0beta.24.
Hash table slack 0.300000 Loading FASTA file 'CP009072.1.fasta' into memory... FASTA file contained a character that's not a valid base (or N): 'Y', full line 'TGCGGCCCCGGAAAATGAAAACATGGCCGGACATGGGATCGTCTTTCAGCGCCGTYTGTACTTTCGCAGC'; converting to 'N'. This may happen again, but there will be no more warnings. 0s Saving genome...0s Computing bias table. Computed bias table in 0s Allocating memory for hash tables...0s Building hash tables. 53749(1%) seeds occur more than once, total of 132985(2%) genome locations are not unique, 764(0%) bad seeds, 0 both complements used 500 no string Hash table build took 0s Building overflow table. Overflow table build and hash table save took 0s Saving overflow table...0s Index build and save took 0s (5131767 bases/s)`
after build index:
`snap-aligner single CP009072_index/ SRR2061818.fastq -o alignment_CP009072_result.sam Welcome to SNAP version 1.0beta.24.
Loading index from directory... 0s. 5131767 bases, seed size 20 Aligning. Segmentation fault (core dumped)`
i dont know why the error happen. could someone help me? CP009072.1.fasta download from here SRR2061818.fastq download from here SRR2061818,fastq link is here: ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR206/008/SRR2061818/SRR2061818.fastq.gz