mikessh
commented
7 years ago Donor MHCs should go to separate columns, meta.donor.MHC. The actual complex that binds TCR is the primary information which goes to mhc.a, etc.
Closed RenskeVroomans closed 7 years ago
mikessh
commented
7 years ago Donor MHCs should go to separate columns, meta.donor.MHC. The actual complex that binds TCR is the primary information which goes to mhc.a, etc.
http://jvi.asm.org/content/81/4/1619 sequencing classified as "sanger". Note: all sequences were supposedly obtained with an HLA-B57:01 tetramer, but some of the individuals are actually HLA-B57:03. This is indicated in the table under subject cohort and the donor MHC column.
"mRNA was extracted from tetramer-positive CD8+ T cells using an RNeasy mini kit (QIAGEN, Valencia, CA). Anchored reverse transcription-PCR was then performed using a modified version of the SMART (switching mechanism at 5′ end of RNA transcript) procedure and a TCR α- or β-chain constant region 3′ primer to obtain PCR products containing the variable (V) α or β chain in addition to the CDR3 region, the joining (J) α/β region, and the beginning of the constant (C) α/β region. Briefly, reverse transcription was carried out at 42°C for 90 min with primers provided for the 5′ rapid amplification of cDNA ends reaction in a SMART-rapid amplification of cDNA ends PCR kit (BD Biosciences). First- and second-round PCR were then performed using a universal 5′ end primer (5′-CTAATACGACTCACTATAGGGC-3′) and nested gene-specific 3′ end primers annealing to the constant region of the TCR α or β chain (Cα outer, GTCCATAGACCTCATGTCTAGCACAG; Cα inner, ATACACATCAGAATCCTTACTTTG; Cβ outer, 5′-TGTGGCCAGGCACACCAGTGTGGCC-3′; Cβ inner, 5′-GGTGTGGGAGATCTCTGCTTCTGA-3′). PCR conditions were as follows: for the first run, 5 cycles of 95° for 30 s and 72° for 2 min; 5 cycles of 95° for 30 s, 70° for 30 s, and 72°for 2 min; and 25 cycles of 95° for 30 s, 60° for 30 s, and 72° for 1 min. For the second run, the program was 30 cycles of 95° for 30 s, 60° for 30 s, and 72° for 1 min. The PCR product was ligated into the TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and used to transform Escherichia coli (Mach 1; Invitrogen). Colonies were selected, amplified by PCR with M13 primers, and sequenced by T7 or T3 primers on an ABI 3100 PRISM automated sequencer. Sequences were edited and aligned using Sequencher (Gene Codes Corp., Ann Arbor, MI) and Se-Al (University of Oxford, Oxford, United Kingdom) and compared to the human TCR genes database (http://imgt.cines.fr:8104/home.html). The TCR Vα/β chain classification system used is that of the international ImMunoGeneTics database (19). "