arq5x / bedtools2

bedtools - the swiss army knife for genome arithmetic
MIT License
941 stars 287 forks source link

bamtobed WARNING #1063

Open songxh1996 opened 1 year ago

songxh1996 commented 1 year ago

Hello, When I try to apply bamtobed to the resultant bedpe file, I repeatedly encounter the following warning: I'd be very grateful for your help on resolving this issue.

> bedtools bamtobed -bedpe -mate1 -i liver1.bam | sort -k1,1 -k2,2n -k3,3n | gzip -nc > liver1.bedpe.gz ... ... WARNING: Query V350018083L2C003R0520110094 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L1C001R0480072535 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V300107794L3C001R0431160596 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V300107794L3C002R0670458802 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L2C003R0520110094 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L1C003R0070349748 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L1C002R0031107013 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L2C003R0240356214 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L1C003R0070349748 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L1C002R0031107013 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L2C003R0240356214 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V300107794L3C002R0630068506 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L2C003R0531058280 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V300107794L3C002R0630068506 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L2C002R0701269478 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L2C003R0531058280 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L2C002R0701269478 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. WARNING: Query V350018083L2C003R0371173268 is marked as paired, but its mate does not occur next to it in your BAM file. Skipping. ***WARNING: Query V350018083L2C003R0371173268** is marked as paired, but its mate does not occur next to it in your BAM file. Skipping.

> samtools view -h liver1.bam |grep -n V350018083L2C003R0371173268

27917219:V350018083L2C003R0371173268 163 chr1 143532689 32 49M = 143532700 61 CTCTCAGTCTGTGTGTCTTGCTCTCTGAGTGTGTGTGAATCTGTGGGTC GGFFFFGFEGFFGFGFFFFGFFFFFFGBFFGFGFGFFEFGFGGEFGFEF MD:Z:49 PG:Z:MarkDuplicates XG:i:0 NM:i:0 XM:i:0 XN:i:0 XO:i:0 AS:i:0 XS:i:-10 YS:i:0 YT:Z:CP 27917222:V350018083L2C003R0371173268 83 chr1 143532700 32 50M = 143532689 -61 TGTGTCTTGCTCTCTGAGTGTGTGTGAATCTGTGGGTCCCTGTGTGTGTG FFGFFGFGGGFGFGGGFFFFFFGFGGGGFGHFGFFFFFFFGFGGGGGFGG MD:Z:50 PG:Z:MarkDuplicates XG:i:0 NM:i:0 XM:i:0 XN:i:0 XO:i:0 AS:i:0 XS:i:-10 YS:i:0 YT:Z:CP