search

artic-network / artic-ncov2019

ARTIC nanopore protocol for nCoV2019 novel coronavirus
Creative Commons Attribution 4.0 International
168 stars 166 forks source link

align_trim ValueError: min() arg is an empty sequence (artic 1.2.1) #97

Closed thierryjanssens closed 2 years ago

thierryjanssens commented 2 years ago

Hi all,

I am using artic for amplicon sequencing (nanopore) of viral genomes. However, I get a consensus of N's and I traced back the problem to the align_trim step, since I get the following error:

ValueError: min() arg is an empty sequence

my virus.scheme.bed is: virus 8 32 F1_On_LEFT 1 + CAACATATACCAACAACAAA virus 2090 2112 R1_On_RIGHT 1 - ATGTGGAATTGCTCTAATGACT virus 1878 1898 F2_ON_LEFT 1 + CGGACTGACTCTTACATTCG virus 3954 3975 R2_On_RIGHT 1 - ATATGCCTGTACTGATCAACG virus 3649 3674 F3_On_LEFT 1 + ACTGATTCCAATGGTACGAA virus 5043 5057 R3_On_RIGHT 1 - GTAAATTGACTTCGGACAAAGAT virus 4801 4820 F4_On_LEFT 1 + GCTGTGAGTGAGGTCCATA virus 6313 6334 R4_On_RIGHT 1 - CTACGGATGTGTATGAACCAT

How can I get around this error?

Looking forward for any suggestions.

kind regards,

Thierry

thierryjanssens commented 2 years ago

Match with name of reference is primer name is essential. referencename_primernumber_orientation e.g. virus_1_LEFT Solved.