Open Salvobioinfo opened 5 years ago
I modified manifest file in:
reference_genome: /solid/Reference/GRCh38/GRCh38.d1.vd1.fa
output_folder: /tank/home/salvo/KATIA/OUTPUT
bwa: bwa
bedtools: bedtools
demultiplex_min_reads: 100000
undemultiplexed:
forward: /tank/USB/Undetermined_S0_L001_R1_001.fastq.gz
reverse: /tank/USB/Undetermined_S0_L001_R2_001.fastq.gz
index1: /tank/USB/Undetermined_S0_L001_I1_001.fastq.gz
index2: /tank/USB/Undetermined_S0_L001_I2_001.fastq.gz
samples:
control:
target:
barcode1: GCTCAGGA
barcode2: CTCTCTAT
description: Control
HekMECP2neg:
target: GATTTTGACTTCACGGTAACTGG
barcode1: CTAGTACG
barcode2: TAGATCGC
description: Hek-MECP2ne
But I obtained always same results.
If you increase the "demultiplex_min_reads" even more? I set mine to 50000.
@martinaryee @vedtopkar It's unfortunately clearly broken. It would be highly appreciated if you could take a look at the demultiplexing step again.
I have the same errors as @Salvobioinfo .
@Zethson In the first our attempt the issue was due to the sequencing problems, Indeed I tried to demultiplex our data with different tools and only one sample has a good reads amount. Did you try it ? To validate if these problem are linked with our seqeuncing step, I ran guideseq with good samples obtained from other people, and tool worked well.
Running command line:
python guideseq.py all -m manifest_1.yaml
after demultiplexing begins I receive:IOError: [Errno 24] Too many open files: ...
Upon inspection of the demultiplexed output directory, there is one file for every barcode. I saw other issue like mine, but others solutions don't work for me. My manifest file is:
Any idea what is going on here? Salvatore