Output terms explaining difference between sum of loop energies and total energies

[ash211]

Below, the sum of energy of loops and Minimum Free Energy are different.

GTfold: A Scalable Multicore Code for RNA Secondary Structure Prediction (c) 2007-2011 D.A. Bader, S. Mallidi, A. Mathuriya, C.E. Heitsch, S.C. Harvey Georgia Institute of Technology

Run Configuration:

• standard
• thermodynamic parameters: /usr/local/share/gtfold/Turner99/
• input file: test_data/sequences/5S/d.5.a.D.mobilis.seq
  • sequence length: 133
  • sequence contents: ACGGUGCCCGACCCGGCCAUAGUGGCCGGGCAACACCCGGUCUCGUUUCGAACCCGGAAGUUAAGCCGGCCACGUCAGAACGGCCGUGAGGUCCGAGAGGCCUCGCAGCCGUUCUGAGCUGGGAUCGGGCACC
• output file: test_data/sequences/5S/d.5.a.D.mobilis.ct

Computing minimum free energy structure... Thread count: 2 Done.

Computing MFE traceback...

• sum of energy of loops: -92.30 kcal/mol Done.

Results:

• Minimum Free Energy: -92.6000 kcal/mol
• MFE runtime: 0.021994 seconds
• MFE traceback runtime: 0.000048 seconds

MFE structure: ACGGUGCCCGACCCGGCCAUAGUGGCCGGGCAACACCCGGUCUCGUUUCGAACCCGGAAGUUAAGCCGGCCACGUCAGAACGGCCGUGAGGUCCGAGAGGCCUCGCAGCCGUUCUGAGCUGGGAUCGGGCACC ..(((((((((((((((....((((((((..(((..((((..(((...)))..))))..)))...)))))))).((((((((((.((((((.((....)))))))).)))))))))))))))).)))))))))

MFE structure saved in .ct format to test_data/sequences/5S/d.5.a.D.mobilis.ct

[ash211]

Fixed by Prashant in commit

https://github.com/ash211/gtfold/commit/05f19debb21e08b95cb41aa8f85c4fcdc422ae1c