Closed Maja-nib closed 7 years ago
Thanks for using sPARTA. I think there is something wrong with miRNA file format. Could you please paste the output of command:
head endogenous_sRNAs.fa
Atul
Hello,
I attached the head of miRNA file in FASTA format. Thank you for your help.
Kind regards,
Maja
Maja Križnik Nacionalni inštitut za biologijohttp://www.nib.si/ / National Institute of Biologyhttp://www.nib.si/eng/ Oddelek za biotehnologijo in sistemsko biologijohttp://www.nib.si/oddelki/oddelek-za-biotehnologijo-in-sistemsko-biologijo Department of Biotechnology and Systems Biologyhttp://www.nib.si/eng/index.php/departments/department-of-biotechnology-and-systems-biology Večna pot 111, SI-1000 Ljubljana, Slovenia
Phone: + 386 (0)59 232 813 Fax: + 386 (0)1 257 38 47 E-mail: maja.kriznik@nib.simailto:maja.kriznik@nib.si
[cid:image002.png@01D1B29C.4199B610]
From: Atul Kakrana [mailto:notifications@github.com] Sent: Tuesday, July 04, 2017 10:31 PM To: atulkakrana/sPARTA sPARTA@noreply.github.com Cc: Maja Križnik Maja.Kriznik@nib.si; Author author@noreply.github.com Subject: Re: [atulkakrana/sPARTA] ValueError: could not convert string to float: 'AAACTCACTCTGTTCTCTCA' (#6)
Thanks for using sPARTA. I think there is something wrong with miRNA file format. Could you please paste the output of command: head endogenous_sRNAs.fa
Atul
— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHubhttps://github.com/atulkakrana/sPARTA/issues/6#issuecomment-312947861, or mute the threadhttps://github.com/notifications/unsubscribe-auth/AcgAdy3xZin316wI2vf4srSJWJNTijN5ks5sKp6wgaJpZM4OM_ek.
Hi Maja,
It seems you forgot to attach the file. Can you paste the information here?
Atul
Hi Maja,
I'm actually suspecting that there is a problem with the predicted targets file. Could you also paste the head of the All.targs.parsed.csv file (located in the predicted folder). Index 5 should be the score, but it looks like it is one of the sequences.
Hi,
It took a while but I finally, figured out what was wrong. I played with diffferent input sRNAs files and transcriptome files and what I discovered was that the message I got ValueError: could not convert string to float: 'AAACTCACTCTGTTCTCTCA' was due to complex header names in my transcriptome fasta file, when I simplified them, everything works.
I am happy to know that you successfully investigated and resolved the problem. All the best with you analyses.
Atul
Dear Atul,
I run your pipeline SPARTA.py with this command:/usr/bin/python3.4 sPARTA.py -featureFile redundant.fa -miRNAFile endogenous_sRNAs.fa -genomeFeature 0 -libs Tally_library1.txt -tarPred -tarScore --tag2FASTA --map2DD --validate
However the process stopped and the output map is empty, on the other hand the map predicted contains files. The last part that terminal shows is this:
multiprocessing.pool.RemoteTraceback: """ Traceback (most recent call last): File "/usr/lib/python3.4/multiprocessing/pool.py", line 119, in worker result = (True, func(*args, *kwds)) File "/usr/lib/python3.4/multiprocessing/pool.py", line 44, in mapstar return list(map(args)) File "sPARTA.py", line 1821, in validatedTargetsFinder categoryList[int(categoryScore)]) File "sPARTA.py", line 1706, in pValueCalculator n = sum(x.count(miRNAName) for x in targetFinderList if float(x[5]) == File "sPARTA.py", line 1706, in
n = sum(x.count(miRNAName) for x in targetFinderList if float(x[5]) ==
ValueError: could not convert string to float: 'AAACTCACTCTGTTCTCTCA'
"""
The above exception was the direct cause of the following exception:
Traceback (most recent call last): File "sPARTA.py", line 2921, in
main()
File "sPARTA.py", line 2872, in main
validatedTargetsList = PPResults(validatedTargetsFinder, PAGeIndexList)
File "sPARTA.py", line 1608, in PPResults
results = (res.get())
File "/usr/lib/python3.4/multiprocessing/pool.py", line 599, in get
raise self._value
ValueError: could not convert string to float: 'AAACTCACTCTGTTCTCTCA'
Do you have any idea what could be wrong? Thank you very much. Kind regards. Maja