How to use Pre-alignment processing perl script?

[LuShuYangMing]

Hi

I have downloaded scripts from http://www.bcgsc.ca/platform/bioinfo/software/adapter-trimming-for-small-rna-sequencing. When I run this script by using perl adapter_trim.pl -a TACTCTCGTATGCCGTCTTCTG SRRxxxx.fastq.gz command, the program took a long time to run without stopping. I don't understand how to deal with this problem, would you like to show a detail tutorial about trimming adpator process?

And another question is the following http link http://www.bcgsc.ca/platform/bioinfo/software/adapter-trimming-for-small-rna-sequencing is not available now, would you like to give a new http link?

Thank you very much for your help

lushuyangming

[AGordonRobertson]

LuShuYangMing,

I apologize for the delay in getting back to you on these issues.

1. Would you try running the adapter-trimming script by decompressing the .gz file and the piping the output into the Perl script. zcat SRRxxxx.fastq.gz | perl adapter_trim.pl -a TACTCTCGTATGCCGTCTTCTG

2. Our web site structure was recently changed. We’ve flagged with our technical people that the link was broken. We expect this to be fixed reasonbly quickly.

Thank you,

Gordon Robertson

On Nov 22, 2019, at 9:07 AM, LuShuYangMing notifications@github.com<mailto:notifications@github.com> wrote:

I have downloaded scripts from http://www.bcgsc.ca/platform/bioinfo/software/adapter-trimming-for-small-rna-sequencing<x-msg://72/url>. When I run this script by using perl adapter_trim.pl -a TACTCTCGTATGCCGTCTTCTG SRRxxxx.fastq.gz command, the program took a long time to run without stopping. I don't understand how to deal with this problem, would you like to show a detail tutorial about trimming adpator process?

And another question is the following http link http://www.bcgsc.ca/platform/bioinfo/software/adapter-trimming-for-small-rna-sequencing<x-msg://72/url> is not available now, would you like to give a new http link?

— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHubhttps://github.com/bcgsc/mirna/issues/5?email_source=notifications&email_token=ABT6GSSUD56HDQMKAC5ORCDQVAGWHA5CNFSM4JQTQ3IKYY3PNVWWK3TUL52HS4DFUVEXG43VMWVGG33NNVSW45C7NFSM4H3OE3LA, or unsubscribehttps://github.com/notifications/unsubscribe-auth/ABT6GSSZJP6GBC62627UY7DQVAGWHANCNFSM4JQTQ3IA.