search

bcgsc / straglr

Tandem repeat expansion detection or genotyping from long-read alignments
Other
50 stars 9 forks source link

Interpretation on <output_prefix>.tsv #37

Closed HLHsieh closed 2 months ago

HLHsieh commented 2 months ago

Hi there,

I've received an output file, and according to the readme, the allele column should indicate the allele to which the support read is assigned, based on the genotype results. I'm puzzled as to why it's displaying NA instead of 34.5, and why it does not consider 349.2 as the second allele.

chr19   1049437 1050023 CCCCGTGAGCCCCCCACCACTCCCT   chr19:1049437-1050023   15  34.5(13)    40b2e343-cc45-4c7c-9714-bede62e39748    CCCGTGAGCCCCCCACCACTCCCTC,CCCGTGAGCCCCCCACCACTCCCTCCCCGTGAGCCCCCACACCCTC    34.0    850 15218   -   34.5    full
chr19   1049437 1050023 CCCCGTGAGCCCCCCACCACTCCCT   chr19:1049437-1050023   15  34.5(13)    9fef502d-c95e-47e6-b8e7-7e3f3de33850    GCCCCCACCACTCCCTCCCCGTGA    34.0    849 7101    +   34.5    full
chr19   1049437 1050023 CCCCGTGAGCCCCCCACCACTCCCT   chr19:1049437-1050023   15  34.5(13)    4a03adc1-1d6a-4efe-a38d-fb5fa7a12581    TGAGCCCCCACCACTCCCTCCCCG    34.0    849 744 +   34.5    full
chr19   1049437 1050023 CCCCGTGAGCCCCCCACCACTCCCT   chr19:1049437-1050023   15  34.5(13)    43170596-da45-4fd9-b4a0-a26c934cf4c3    CCTCCCCGTGAGCCCCCACCACTC    32.4    810 480 +   34.5    full
chr19   1049437 1050023 CCCCGTGAGCCCCCCACCACTCCCT   chr19:1049437-1050023   15  34.5(13)    8ed4d156-5898-46a9-b4a2-12c9be80944f    CCCCGTGAGCCCCCACCACTCCCT    32.2    804 2157    +   34.5    full
chr19   1049437 1050023 CCCCGTGAGCCCCCCACCACTCCCT   chr19:1049437-1050023   15  34.5(13)    37df087b-09e5-4b7c-bf5e-452310692056    CCCCGTGGGCCCCCCACCACTCCCT   349.2   8730    2280    +   NA  full

Any comment would be appreciated.

Best, Hsin

readmanchiu commented 2 months ago

Hi @HLHsieh,

The reason is 349.2 has only 1 support read, you need at least 2 to confirm the allele.

Thanks for using Straglr