search

benjjneb / dada2

Accurate sample inference from amplicon data with single nucleotide resolution
http://benjjneb.github.io/dada2/
GNU Lesser General Public License v3.0
469 stars 142 forks source link

All the rows of seqtab.nochim are NA #1870

Closed radhiasdf closed 9 months ago

radhiasdf commented 9 months ago

I'm trying this on my 40 samples. My issue is that all the rows of seqtab.nochim are NA, except for the first row which has one of the fastq.gz files. I think this is what made the error when trying to construct a phyloseq object (towards the end). All the previous steps seemed to run successfully. What went wrong? I might have muddled up the procedure. Thank you so much.

Here is all the code on the console if useful:

> path <- "C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered"
> path <- "C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered"
> 
> list.files(path)
 [1] "LFGCM-8276-01-0-1_F_filt.fastq.gz" "LFGCM-8276-01-0-1_R_filt.fastq.gz" "LFGCM-8276-02-0-1_F_filt.fastq.gz"
 [4] "LFGCM-8276-02-0-1_R_filt.fastq.gz" "LFGCM-8276-03-0-1_F_filt.fastq.gz" "LFGCM-8276-03-0-1_R_filt.fastq.gz"
 [7] "LFGCM-8276-04-0-1_F_filt.fastq.gz" "LFGCM-8276-04-0-1_R_filt.fastq.gz" "LFGCM-8276-05-0-1_F_filt.fastq.gz"
[10] "LFGCM-8276-05-0-1_R_filt.fastq.gz" "LFGCM-8276-06-0-1_F_filt.fastq.gz" "LFGCM-8276-06-0-1_R_filt.fastq.gz"
[13] "LFGCM-8276-07-0-1_F_filt.fastq.gz" "LFGCM-8276-07-0-1_R_filt.fastq.gz" "LFGCM-8276-08-0-1_F_filt.fastq.gz"
[16] "LFGCM-8276-08-0-1_R_filt.fastq.gz" "LFGCM-8276-09-0-1_F_filt.fastq.gz" "LFGCM-8276-09-0-1_R_filt.fastq.gz"
[19] "LFGCM-8276-10-0-1_F_filt.fastq.gz" "LFGCM-8276-10-0-1_R_filt.fastq.gz" "LFGCM-8276-11-0-1_F_filt.fastq.gz"
[22] "LFGCM-8276-11-0-1_R_filt.fastq.gz" "LFGCM-8276-12-0-1_F_filt.fastq.gz" "LFGCM-8276-12-0-1_R_filt.fastq.gz"
[25] "LFGCM-8276-13-0-1_F_filt.fastq.gz" "LFGCM-8276-13-0-1_R_filt.fastq.gz" "LFGCM-8276-14-0-1_F_filt.fastq.gz"
[28] "LFGCM-8276-14-0-1_R_filt.fastq.gz" "LFGCM-8276-15-0-1_F_filt.fastq.gz" "LFGCM-8276-15-0-1_R_filt.fastq.gz"
[31] "LFGCM-8276-16-0-1_F_filt.fastq.gz" "LFGCM-8276-16-0-1_R_filt.fastq.gz" "LFGCM-8276-17-0-1_F_filt.fastq.gz"
[34] "LFGCM-8276-17-0-1_R_filt.fastq.gz" "LFGCM-8276-18-0-1_F_filt.fastq.gz" "LFGCM-8276-18-0-1_R_filt.fastq.gz"
[37] "LFGCM-8276-19-0-1_F_filt.fastq.gz" "LFGCM-8276-19-0-1_R_filt.fastq.gz" "LFGCM-8276-20-0-1_F_filt.fastq.gz"
[40] "LFGCM-8276-20-0-1_R_filt.fastq.gz" "LFGCM-8276-21-0-1_F_filt.fastq.gz" "LFGCM-8276-21-0-1_R_filt.fastq.gz"
[43] "LFGCM-8276-22-0-1_F_filt.fastq.gz" "LFGCM-8276-22-0-1_R_filt.fastq.gz" "LFGCM-8276-23-0-1_F_filt.fastq.gz"
[46] "LFGCM-8276-23-0-1_R_filt.fastq.gz" "LFGCM-8276-24-0-1_F_filt.fastq.gz" "LFGCM-8276-24-0-1_R_filt.fastq.gz"
[49] "LFGCM-8276-25-0-1_F_filt.fastq.gz" "LFGCM-8276-25-0-1_R_filt.fastq.gz" "LFGCM-8276-26-0-1_F_filt.fastq.gz"
[52] "LFGCM-8276-26-0-1_R_filt.fastq.gz" "LFGCM-8276-27-0-1_F_filt.fastq.gz" "LFGCM-8276-27-0-1_R_filt.fastq.gz"
[55] "LFGCM-8276-28-0-1_F_filt.fastq.gz" "LFGCM-8276-28-0-1_R_filt.fastq.gz" "LFGCM-8276-29-0-1_F_filt.fastq.gz"
[58] "LFGCM-8276-29-0-1_R_filt.fastq.gz" "LFGCM-8276-30-0-1_F_filt.fastq.gz" "LFGCM-8276-30-0-1_R_filt.fastq.gz"
[61] "LFGCM-8276-31-0-1_F_filt.fastq.gz" "LFGCM-8276-31-0-1_R_filt.fastq.gz" "LFGCM-8276-32-0-1_F_filt.fastq.gz"
[64] "LFGCM-8276-32-0-1_R_filt.fastq.gz" "LFGCM-8276-33-0-1_F_filt.fastq.gz" "LFGCM-8276-33-0-1_R_filt.fastq.gz"
[67] "LFGCM-8276-34-0-1_F_filt.fastq.gz" "LFGCM-8276-34-0-1_R_filt.fastq.gz" "LFGCM-8276-35-0-1_F_filt.fastq.gz"
[70] "LFGCM-8276-35-0-1_R_filt.fastq.gz" "LFGCM-8276-36-0-1_F_filt.fastq.gz" "LFGCM-8276-36-0-1_R_filt.fastq.gz"
[73] "LFGCM-8276-37-0-1_F_filt.fastq.gz" "LFGCM-8276-37-0-1_R_filt.fastq.gz" "LFGCM-8276-38-0-1_F_filt.fastq.gz"
[76] "LFGCM-8276-38-0-1_R_filt.fastq.gz" "LFGCM-8276-39-0-1_F_filt.fastq.gz" "LFGCM-8276-39-0-1_R_filt.fastq.gz"
[79] "LFGCM-8276-40-0-1_F_filt.fastq.gz" "LFGCM-8276-40-0-1_R_filt.fastq.gz"
> 
> # Forward and reverse fastq filenames have format: SAMPLENAME_R1_001.fastq and SAMPLENAME_R2_001.fastq
> filtFs <- sort(list.files(path, pattern="_F_filt.fastq", full.names = TRUE))
> filtRs <- sort(list.files(path, pattern="_R_filt.fastq", full.names = TRUE))
> 
> 
> errF <- learnErrors(filtFs, multithread=FALSE)
100215718 total bases in 553678 reads from 10 samples will be used for learning the error rates.
> errR <- learnErrors(filtRs, multithread=FALSE)
109806300 total bases in 610035 reads from 11 samples will be used for learning the error rates.
> 
> #plotErrors(errF, nominalQ=TRUE)
> #plotErrors(errR, nominalQ=TRUE)
> 
> derepFs <- derepFastq(filtFs, verbose=TRUE)
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-01-0-1_F_filt.fastq.gz
Encountered 11324 unique sequences from 49913 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-02-0-1_F_filt.fastq.gz
Encountered 14689 unique sequences from 64763 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-03-0-1_F_filt.fastq.gz
Encountered 11171 unique sequences from 46929 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-04-0-1_F_filt.fastq.gz
Encountered 15334 unique sequences from 65275 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-05-0-1_F_filt.fastq.gz
Encountered 12178 unique sequences from 51001 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-06-0-1_F_filt.fastq.gz
Encountered 8352 unique sequences from 38571 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-07-0-1_F_filt.fastq.gz
Encountered 11872 unique sequences from 61124 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-08-0-1_F_filt.fastq.gz
Encountered 12802 unique sequences from 58565 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-09-0-1_F_filt.fastq.gz
Encountered 16631 unique sequences from 70502 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-10-0-1_F_filt.fastq.gz
Encountered 12401 unique sequences from 47035 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-11-0-1_F_filt.fastq.gz
Encountered 11544 unique sequences from 56357 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-12-0-1_F_filt.fastq.gz
Encountered 11846 unique sequences from 55522 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-13-0-1_F_filt.fastq.gz
Encountered 13588 unique sequences from 61777 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-14-0-1_F_filt.fastq.gz
Encountered 13811 unique sequences from 61618 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-15-0-1_F_filt.fastq.gz
Encountered 11049 unique sequences from 49054 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-16-0-1_F_filt.fastq.gz
Encountered 9566 unique sequences from 42973 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-17-0-1_F_filt.fastq.gz
Encountered 10279 unique sequences from 44923 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-18-0-1_F_filt.fastq.gz
Encountered 13409 unique sequences from 53541 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-19-0-1_F_filt.fastq.gz
Encountered 10203 unique sequences from 46136 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-20-0-1_F_filt.fastq.gz
Encountered 9322 unique sequences from 48954 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-21-0-1_F_filt.fastq.gz
Encountered 11573 unique sequences from 56657 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-22-0-1_F_filt.fastq.gz
Encountered 10096 unique sequences from 53720 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-23-0-1_F_filt.fastq.gz
Encountered 10212 unique sequences from 54924 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-24-0-1_F_filt.fastq.gz
Encountered 9613 unique sequences from 50198 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-25-0-1_F_filt.fastq.gz
Encountered 13164 unique sequences from 56316 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-26-0-1_F_filt.fastq.gz
Encountered 9773 unique sequences from 43324 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-27-0-1_F_filt.fastq.gz
Encountered 16464 unique sequences from 57600 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-28-0-1_F_filt.fastq.gz
Encountered 9136 unique sequences from 46749 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-29-0-1_F_filt.fastq.gz
Encountered 11284 unique sequences from 55671 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-30-0-1_F_filt.fastq.gz
Encountered 12523 unique sequences from 56419 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-31-0-1_F_filt.fastq.gz
Encountered 8987 unique sequences from 44141 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-32-0-1_F_filt.fastq.gz
Encountered 8347 unique sequences from 48613 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-33-0-1_F_filt.fastq.gz
Encountered 8909 unique sequences from 46631 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-34-0-1_F_filt.fastq.gz
Encountered 11522 unique sequences from 54211 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-35-0-1_F_filt.fastq.gz
Encountered 10692 unique sequences from 48188 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-36-0-1_F_filt.fastq.gz
Encountered 10637 unique sequences from 50799 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-37-0-1_F_filt.fastq.gz
Encountered 12142 unique sequences from 56713 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-38-0-1_F_filt.fastq.gz
Encountered 11612 unique sequences from 56370 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-39-0-1_F_filt.fastq.gz
Encountered 9472 unique sequences from 46448 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-40-0-1_F_filt.fastq.gz
Encountered 12780 unique sequences from 56446 total sequences read.
> derepRs <- derepFastq(filtRs, verbose=TRUE)
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-01-0-1_R_filt.fastq.gz
Encountered 10029 unique sequences from 49913 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-02-0-1_R_filt.fastq.gz
Encountered 13381 unique sequences from 64763 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-03-0-1_R_filt.fastq.gz
Encountered 9070 unique sequences from 46929 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-04-0-1_R_filt.fastq.gz
Encountered 13577 unique sequences from 65275 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-05-0-1_R_filt.fastq.gz
Encountered 11166 unique sequences from 51001 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-06-0-1_R_filt.fastq.gz
Encountered 7891 unique sequences from 38571 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-07-0-1_R_filt.fastq.gz
Encountered 11720 unique sequences from 61124 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-08-0-1_R_filt.fastq.gz
Encountered 11419 unique sequences from 58565 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-09-0-1_R_filt.fastq.gz
Encountered 15471 unique sequences from 70502 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-10-0-1_R_filt.fastq.gz
Encountered 10683 unique sequences from 47035 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-11-0-1_R_filt.fastq.gz
Encountered 10739 unique sequences from 56357 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-12-0-1_R_filt.fastq.gz
Encountered 11227 unique sequences from 55522 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-13-0-1_R_filt.fastq.gz
Encountered 12768 unique sequences from 61777 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-14-0-1_R_filt.fastq.gz
Encountered 12614 unique sequences from 61618 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-15-0-1_R_filt.fastq.gz
Encountered 10235 unique sequences from 49054 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-16-0-1_R_filt.fastq.gz
Encountered 8373 unique sequences from 42973 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-17-0-1_R_filt.fastq.gz
Encountered 10706 unique sequences from 44923 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-18-0-1_R_filt.fastq.gz
Encountered 12048 unique sequences from 53541 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-19-0-1_R_filt.fastq.gz
Encountered 10199 unique sequences from 46136 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-20-0-1_R_filt.fastq.gz
Encountered 10374 unique sequences from 48954 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-21-0-1_R_filt.fastq.gz
Encountered 12530 unique sequences from 56657 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-22-0-1_R_filt.fastq.gz
Encountered 11702 unique sequences from 53720 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-23-0-1_R_filt.fastq.gz
Encountered 11846 unique sequences from 54924 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-24-0-1_R_filt.fastq.gz
Encountered 10668 unique sequences from 50198 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-25-0-1_R_filt.fastq.gz
Encountered 12595 unique sequences from 56316 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-26-0-1_R_filt.fastq.gz
Encountered 9379 unique sequences from 43324 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-27-0-1_R_filt.fastq.gz
Encountered 17431 unique sequences from 57600 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-28-0-1_R_filt.fastq.gz
Encountered 10053 unique sequences from 46749 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-29-0-1_R_filt.fastq.gz
Encountered 11617 unique sequences from 55671 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-30-0-1_R_filt.fastq.gz
Encountered 12022 unique sequences from 56419 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-31-0-1_R_filt.fastq.gz
Encountered 10372 unique sequences from 44141 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-32-0-1_R_filt.fastq.gz
Encountered 10500 unique sequences from 48613 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-33-0-1_R_filt.fastq.gz
Encountered 9433 unique sequences from 46631 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-34-0-1_R_filt.fastq.gz
Encountered 11362 unique sequences from 54211 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-35-0-1_R_filt.fastq.gz
Encountered 10841 unique sequences from 48188 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-36-0-1_R_filt.fastq.gz
Encountered 10398 unique sequences from 50799 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-37-0-1_R_filt.fastq.gz
Encountered 11797 unique sequences from 56713 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-38-0-1_R_filt.fastq.gz
Encountered 11635 unique sequences from 56370 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-39-0-1_R_filt.fastq.gz
Encountered 10146 unique sequences from 46448 total sequences read.
Dereplicating sequence entries in Fastq file: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/primerfiltered/LFGCM-8276-40-0-1_R_filt.fastq.gz
Encountered 11731 unique sequences from 56446 total sequences read.
> # Name the derep-class objects by the sample names
> names(derepFs) <- sample.names
> names(derepRs) <- sample.names
> 
> dadaFs <- dada(derepFs, err=errF, multithread=TRUE)
Sample 1 - 49913 reads in 11324 unique sequences.
Sample 2 - 64763 reads in 14689 unique sequences.
Sample 3 - 46929 reads in 11171 unique sequences.
Sample 4 - 65275 reads in 15334 unique sequences.
Sample 5 - 51001 reads in 12178 unique sequences.
Sample 6 - 38571 reads in 8352 unique sequences.
Sample 7 - 61124 reads in 11872 unique sequences.
Sample 8 - 58565 reads in 12802 unique sequences.
Sample 9 - 70502 reads in 16631 unique sequences.
Sample 10 - 47035 reads in 12401 unique sequences.
Sample 11 - 56357 reads in 11544 unique sequences.
Sample 12 - 55522 reads in 11846 unique sequences.
Sample 13 - 61777 reads in 13588 unique sequences.
Sample 14 - 61618 reads in 13811 unique sequences.
Sample 15 - 49054 reads in 11049 unique sequences.
Sample 16 - 42973 reads in 9566 unique sequences.
Sample 17 - 44923 reads in 10279 unique sequences.
Sample 18 - 53541 reads in 13409 unique sequences.
Sample 19 - 46136 reads in 10203 unique sequences.
Sample 20 - 48954 reads in 9322 unique sequences.
Sample 21 - 56657 reads in 11573 unique sequences.
Sample 22 - 53720 reads in 10096 unique sequences.
Sample 23 - 54924 reads in 10212 unique sequences.
Sample 24 - 50198 reads in 9613 unique sequences.
Sample 25 - 56316 reads in 13164 unique sequences.
Sample 26 - 43324 reads in 9773 unique sequences.
Sample 27 - 57600 reads in 16464 unique sequences.
Sample 28 - 46749 reads in 9136 unique sequences.
Sample 29 - 55671 reads in 11284 unique sequences.
Sample 30 - 56419 reads in 12523 unique sequences.
Sample 31 - 44141 reads in 8987 unique sequences.
Sample 32 - 48613 reads in 8347 unique sequences.
Sample 33 - 46631 reads in 8909 unique sequences.
Sample 34 - 54211 reads in 11522 unique sequences.
Sample 35 - 48188 reads in 10692 unique sequences.
Sample 36 - 50799 reads in 10637 unique sequences.
Sample 37 - 56713 reads in 12142 unique sequences.
Sample 38 - 56370 reads in 11612 unique sequences.
Sample 39 - 46448 reads in 9472 unique sequences.
Sample 40 - 56446 reads in 12780 unique sequences.
> dadaRs <- dada(derepRs, err=errR, multithread=TRUE)
Sample 1 - 49913 reads in 10029 unique sequences.
Sample 2 - 64763 reads in 13381 unique sequences.
Sample 3 - 46929 reads in 9070 unique sequences.
Sample 4 - 65275 reads in 13577 unique sequences.
Sample 5 - 51001 reads in 11166 unique sequences.
Sample 6 - 38571 reads in 7891 unique sequences.
Sample 7 - 61124 reads in 11720 unique sequences.
Sample 8 - 58565 reads in 11419 unique sequences.
Sample 9 - 70502 reads in 15471 unique sequences.
Sample 10 - 47035 reads in 10683 unique sequences.
Sample 11 - 56357 reads in 10739 unique sequences.
Sample 12 - 55522 reads in 11227 unique sequences.
Sample 13 - 61777 reads in 12768 unique sequences.
Sample 14 - 61618 reads in 12614 unique sequences.
Sample 15 - 49054 reads in 10235 unique sequences.
Sample 16 - 42973 reads in 8373 unique sequences.
Sample 17 - 44923 reads in 10706 unique sequences.
Sample 18 - 53541 reads in 12048 unique sequences.
Sample 19 - 46136 reads in 10199 unique sequences.
Sample 20 - 48954 reads in 10374 unique sequences.
Sample 21 - 56657 reads in 12530 unique sequences.
Sample 22 - 53720 reads in 11702 unique sequences.
Sample 23 - 54924 reads in 11846 unique sequences.
Sample 24 - 50198 reads in 10668 unique sequences.
Sample 25 - 56316 reads in 12595 unique sequences.
Sample 26 - 43324 reads in 9379 unique sequences.
Sample 27 - 57600 reads in 17431 unique sequences.
Sample 28 - 46749 reads in 10053 unique sequences.
Sample 29 - 55671 reads in 11617 unique sequences.
Sample 30 - 56419 reads in 12022 unique sequences.
Sample 31 - 44141 reads in 10372 unique sequences.
Sample 32 - 48613 reads in 10500 unique sequences.
Sample 33 - 46631 reads in 9433 unique sequences.
Sample 34 - 54211 reads in 11362 unique sequences.
Sample 35 - 48188 reads in 10841 unique sequences.
Sample 36 - 50799 reads in 10398 unique sequences.
Sample 37 - 56713 reads in 11797 unique sequences.
Sample 38 - 56370 reads in 11635 unique sequences.
Sample 39 - 46448 reads in 10146 unique sequences.
Sample 40 - 56446 reads in 11731 unique sequences.
> 
> dadaFs[[1]]
dada-class: object describing DADA2 denoising results
166 sequence variants were inferred from 11324 input unique sequences.
Key parameters: OMEGA_A = 1e-40, OMEGA_C = 1e-40, BAND_SIZE = 16
> dadaRs[[1]]
dada-class: object describing DADA2 denoising results
181 sequence variants were inferred from 10029 input unique sequences.
Key parameters: OMEGA_A = 1e-40, OMEGA_C = 1e-40, BAND_SIZE = 16
> 
> mergers <- mergePairs(dadaFs, derepFs, dadaRs, derepRs, verbose=TRUE)
48198 paired-reads (in 169 unique pairings) successfully merged out of 48832 (in 485 pairings) input.
62082 paired-reads (in 175 unique pairings) successfully merged out of 63080 (in 579 pairings) input.
45018 paired-reads (in 93 unique pairings) successfully merged out of 45905 (in 307 pairings) input.
60765 paired-reads (in 421 unique pairings) successfully merged out of 63419 (in 1200 pairings) input.
48912 paired-reads (in 270 unique pairings) successfully merged out of 49919 (in 693 pairings) input.
37027 paired-reads (in 184 unique pairings) successfully merged out of 37728 (in 447 pairings) input.
59367 paired-reads (in 140 unique pairings) successfully merged out of 59900 (in 443 pairings) input.
56375 paired-reads (in 144 unique pairings) successfully merged out of 57339 (in 485 pairings) input.
66882 paired-reads (in 541 unique pairings) successfully merged out of 68591 (in 1273 pairings) input.
44460 paired-reads (in 272 unique pairings) successfully merged out of 45771 (in 790 pairings) input.
53272 paired-reads (in 241 unique pairings) successfully merged out of 55281 (in 581 pairings) input.
53700 paired-reads (in 204 unique pairings) successfully merged out of 54428 (in 554 pairings) input.
59230 paired-reads (in 192 unique pairings) successfully merged out of 60020 (in 641 pairings) input.
59379 paired-reads (in 297 unique pairings) successfully merged out of 60381 (in 648 pairings) input.
46942 paired-reads (in 225 unique pairings) successfully merged out of 47857 (in 614 pairings) input.
41449 paired-reads (in 101 unique pairings) successfully merged out of 42053 (in 290 pairings) input.
43243 paired-reads (in 471 unique pairings) successfully merged out of 44031 (in 870 pairings) input.
51027 paired-reads (in 242 unique pairings) successfully merged out of 52408 (in 718 pairings) input.
43763 paired-reads (in 187 unique pairings) successfully merged out of 45203 (in 547 pairings) input.
47386 paired-reads (in 181 unique pairings) successfully merged out of 48167 (in 415 pairings) input.
55228 paired-reads (in 314 unique pairings) successfully merged out of 55721 (in 626 pairings) input.
52243 paired-reads (in 318 unique pairings) successfully merged out of 52830 (in 595 pairings) input.
53644 paired-reads (in 234 unique pairings) successfully merged out of 54013 (in 467 pairings) input.
48680 paired-reads (in 198 unique pairings) successfully merged out of 49392 (in 448 pairings) input.
53846 paired-reads (in 285 unique pairings) successfully merged out of 55029 (in 819 pairings) input.
41440 paired-reads (in 257 unique pairings) successfully merged out of 42428 (in 590 pairings) input.
50279 paired-reads (in 1106 unique pairings) successfully merged out of 53877 (in 2367 pairings) input.
45533 paired-reads (in 296 unique pairings) successfully merged out of 46024 (in 538 pairings) input.
53822 paired-reads (in 278 unique pairings) successfully merged out of 54626 (in 607 pairings) input.
54384 paired-reads (in 188 unique pairings) successfully merged out of 55116 (in 514 pairings) input.
42559 paired-reads (in 458 unique pairings) successfully merged out of 43122 (in 741 pairings) input.
47627 paired-reads (in 107 unique pairings) successfully merged out of 47929 (in 256 pairings) input.
44827 paired-reads (in 148 unique pairings) successfully merged out of 45790 (in 350 pairings) input.
52496 paired-reads (in 195 unique pairings) successfully merged out of 53031 (in 487 pairings) input.
46405 paired-reads (in 211 unique pairings) successfully merged out of 46999 (in 516 pairings) input.
49271 paired-reads (in 251 unique pairings) successfully merged out of 49759 (in 551 pairings) input.
54877 paired-reads (in 164 unique pairings) successfully merged out of 55421 (in 465 pairings) input.
54387 paired-reads (in 257 unique pairings) successfully merged out of 55111 (in 558 pairings) input.
44808 paired-reads (in 288 unique pairings) successfully merged out of 45289 (in 541 pairings) input.
54303 paired-reads (in 361 unique pairings) successfully merged out of 55253 (in 769 pairings) input.
> # Inspect the merger data.frame from the first sample
> head(mergers[[1]])
                                                                                                                                                                                                                                                       sequence
1 GACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGCCTAATAAGTCAACTGTTAAATCTTGAGGCTCAACTTCAAAATCGCAGTCGAAACTATTAGACTAGAGTATAGTAGAGGTAAAGGGAATTTCCAGTGGAGCGGTGAAATGCGTAGATATTGGAAAGAACACCGATGGCGAAAGCACTTTACTGGGCTATTACTAACACTCAGAGACGAAAGCTAGGGTAGCAAATGGG
2 TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGTAAGACAGAGGTGAAATCCCCGGGCTCAACCTGGGAACTGCCTTTGTGACTGCATAGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCGTGTAGCAGTGAAATGCGTAGATATGCGGAGGAACACCGATGGCGAAGGCAATCCCCTGGACCTGTACTGACGCTCATGCACGAAAGCGTGGGGAGCAAACAGG
3 TACAGAGACTGCAAGCGTTACTCGGATTCACTGGGCGTAAAGGGAGCGCAGGCGGACTCGTGTGTCGGACGTGAAATACCGGGGCTTAACCCCGGTGCTGCGTTCGAAACTACGAGTCTAGAGACTTGGAGGGGTAAGCGGAATTCTTGGTGGAGCAGTGAAATGCGTAGATATCAAGAGGAACACCAACGGCGAAGGCAGCTTACTGGACAAGATCTGACGCTCAGGCTCGAAAGCGTGGGGAGCAAAAGGG
4 TACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTGATTAAGTCAGCGGTGAAAGACTTCGGCTTAACCGGAGCAGTGCCGTTGATACTGATTAGCTTGAGTGTTGGAGGGGTACATGGAATTGATGGTGTAGCGGTGAAATGCATAGATACCATCAGGAACACCGATAGCGAAGGCATTGTACTGGCCAACAACTGACGCTGAGGCACGAAAGTGTGGGGATCGAACAGG
5 TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATACAAGACAGGCGTGAAATCCCCGGGCTTAACCTGGGAATGGCGTCTGTGACTGTATGACTAGAGTGTGTCAGAGGGGGGTAGAATTCCACGTGTAGCAGTGAAATGCGTAGATATGTGGAGGAATACCAATGGCGAAGGCAGCCCCCTGGGATAACACTGACGCTCATGCACGAAAGCGTGGGGAGCAAACAGG
6 TACGGAGGATTCGAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTTTTAAGTCAGTGGTGAAAGCCTGCAGCTCAACTGTAGAATTGCCATTGAAACTGAAAATCTTGAATTTGGTTAAAGTAGGCGGAATGTATCATGTAGCGGTGAAATGCTTAGATATGATACAGAACACCGATAGCGAAGGCAGCTTGCTGAACCAATATTGACGCTGAGGCACGAAAGCGTGGGGAGCAAACAGG
  abundance forward reverse nmatch nmismatch nindel prefer accept
1      7548       1       1    108         0      0      1   TRUE
2      6429       2       2    108         0      0      2   TRUE
3      4191       3       3    108         0      0      1   TRUE
4      3256       4       4    108         0      0      1   TRUE
5      1557      10       5    108         0      0      2   TRUE
6      1230       5       7    108         0      0      1   TRUE
> 
> seqtab <- makeSequenceTable(mergers)
> dim(seqtab)
[1]   40 6084
> # Inspect distribution of sequence lengths
> table(nchar(getSequences(seqtab)))

 202  203  205  215  219  220  221  229  242  244  247  248  251  252  253  254  255  256  257  261  271  272 
  73    1    1    1    1    1    2    1    1    1    1    1    4  162 5373  392   41    8    6    1    1    1 
 282  285  288  289  292  299  309  336 
   1    2    1    1    1    1    2    1 
> 
> seqtab.nochim <- removeBimeraDenovo(seqtab, method="consensus", multithread=TRUE, verbose=TRUE)
Identified 627 bimeras out of 6084 input sequences.
> dim(seqtab.nochim)
[1]   40 5457
> sum(seqtab.nochim)/sum(seqtab)
[1] 0.9916625
> 
> getN <- function(x) sum(getUniques(x))
> track <- cbind(out, sapply(dadaFs, getN), sapply(dadaRs, getN), sapply(mergers, getN), rowSums(seqtab.nochim))
Error: object 'out' not found
> track <- cbind(out, sapply(dadaFs, getN), sapply(dadaRs, getN), sapply(mergers, getN), rowSums(seqtab.nochim))
Error: object 'out' not found
> getN <- function(x) sum(getUniques(x))
> library(phyloseq); packageVersion("phyloseq")
[1] ‘1.46.0’
> library(ggplot2); packageVersion("ggplot2")
Keep up to date with changes at https://www.tidyverse.org/blog/
[1] ‘3.4.4’
> track <- cbind(out, sapply(dadaFs, getN), sapply(dadaRs, getN), sapply(mergers, getN), rowSums(seqtab.nochim))
Error: object 'out' not found
> filtFs <- file.path(path_filtered, "primerfiltered", paste0(sample.names, "_F_filt.fastq.gz"))
Error: object 'path_filtered' not found
> path_filtered <- "C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/filtered"
> 
> list.files(path_filtered)
character(0)
> 
> # Forward and reverse fastq filenames have format: SAMPLENAME_R1_001.fastq and SAMPLENAME_R2_001.fastq
> fnFs <- sort(list.files(path_filtered, pattern="_F_filt.fastq", full.names = TRUE))
> fnRs <- sort(list.files(path_filtered, pattern="_R_filt.fastq", full.names = TRUE))
> # Extract sample names, assuming filenames have format: SAMPLENAME_XXX.fastq
> sample.names <- sapply(strsplit(basename(fnFs), "_"), `[`, 1)
> 
> #plotQualityProfile(fnFs[1:40])
> #plotQualityProfile(fnRs[1:40])
> 
> filtFs <- file.path(path_filtered, "primerfiltered", paste0(sample.names, "_F_filt.fastq.gz"))
> filtRs <- file.path(path_filtered, "primerfiltered", paste0(sample.names, "_R_filt.fastq.gz"))
> 
> out <- filterAndTrim(fnFs, filtFs, fnRs, filtRs, trimLeft=c(19, 20), maxN=0, maxEE=c(2, 2), truncQ=2,
+                      
+                      rm.phix=TRUE, compress=TRUE, multithread=FALSE)
Error in filterAndTrim(fnFs, filtFs, fnRs, filtRs, trimLeft = c(19, 20),  : 
  Every input file must have a corresponding output file.
> path <- "C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation"
> list.files(path)
 [1] "HMP_MOCK.v35.fasta"                         "LFGCM-8276-01-0-1_S1_L001_R1_001.fastq.gz" 
 [3] "LFGCM-8276-01-0-1_S1_L001_R2_001.fastq.gz"  "LFGCM-8276-02-0-1_S2_L001_R1_001.fastq.gz" 
 [5] "LFGCM-8276-02-0-1_S2_L001_R2_001.fastq.gz"  "LFGCM-8276-03-0-1_S3_L001_R1_001.fastq.gz" 
 [7] "LFGCM-8276-03-0-1_S3_L001_R2_001.fastq.gz"  "LFGCM-8276-04-0-1_S4_L001_R1_001.fastq.gz" 
 [9] "LFGCM-8276-04-0-1_S4_L001_R2_001.fastq.gz"  "LFGCM-8276-05-0-1_S5_L001_R1_001.fastq.gz" 
[11] "LFGCM-8276-05-0-1_S5_L001_R2_001.fastq.gz"  "LFGCM-8276-06-0-1_S6_L001_R1_001.fastq.gz" 
[13] "LFGCM-8276-06-0-1_S6_L001_R2_001.fastq.gz"  "LFGCM-8276-07-0-1_S7_L001_R1_001.fastq.gz" 
[15] "LFGCM-8276-07-0-1_S7_L001_R2_001.fastq.gz"  "LFGCM-8276-08-0-1_S8_L001_R1_001.fastq.gz" 
[17] "LFGCM-8276-08-0-1_S8_L001_R2_001.fastq.gz"  "LFGCM-8276-09-0-1_S9_L001_R1_001.fastq.gz" 
[19] "LFGCM-8276-09-0-1_S9_L001_R2_001.fastq.gz"  "LFGCM-8276-10-0-1_S10_L001_R1_001.fastq.gz"
[21] "LFGCM-8276-10-0-1_S10_L001_R2_001.fastq.gz" "LFGCM-8276-11-0-1_S11_L001_R1_001.fastq.gz"
[23] "LFGCM-8276-11-0-1_S11_L001_R2_001.fastq.gz" "LFGCM-8276-12-0-1_S12_L001_R1_001.fastq.gz"
[25] "LFGCM-8276-12-0-1_S12_L001_R2_001.fastq.gz" "LFGCM-8276-13-0-1_S13_L001_R1_001.fastq.gz"
[27] "LFGCM-8276-13-0-1_S13_L001_R2_001.fastq.gz" "LFGCM-8276-14-0-1_S14_L001_R1_001.fastq.gz"
[29] "LFGCM-8276-14-0-1_S14_L001_R2_001.fastq.gz" "LFGCM-8276-15-0-1_S15_L001_R1_001.fastq.gz"
[31] "LFGCM-8276-15-0-1_S15_L001_R2_001.fastq.gz" "LFGCM-8276-16-0-1_S16_L001_R1_001.fastq.gz"
[33] "LFGCM-8276-16-0-1_S16_L001_R2_001.fastq.gz" "LFGCM-8276-17-0-1_S17_L001_R1_001.fastq.gz"
[35] "LFGCM-8276-17-0-1_S17_L001_R2_001.fastq.gz" "LFGCM-8276-18-0-1_S18_L001_R1_001.fastq.gz"
[37] "LFGCM-8276-18-0-1_S18_L001_R2_001.fastq.gz" "LFGCM-8276-19-0-1_S19_L001_R1_001.fastq.gz"
[39] "LFGCM-8276-19-0-1_S19_L001_R2_001.fastq.gz" "LFGCM-8276-20-0-1_S20_L001_R1_001.fastq.gz"
[41] "LFGCM-8276-20-0-1_S20_L001_R2_001.fastq.gz" "LFGCM-8276-21-0-1_S21_L001_R1_001.fastq.gz"
[43] "LFGCM-8276-21-0-1_S21_L001_R2_001.fastq.gz" "LFGCM-8276-22-0-1_S22_L001_R1_001.fastq.gz"
[45] "LFGCM-8276-22-0-1_S22_L001_R2_001.fastq.gz" "LFGCM-8276-23-0-1_S23_L001_R1_001.fastq.gz"
[47] "LFGCM-8276-23-0-1_S23_L001_R2_001.fastq.gz" "LFGCM-8276-24-0-1_S24_L001_R1_001.fastq.gz"
[49] "LFGCM-8276-24-0-1_S24_L001_R2_001.fastq.gz" "LFGCM-8276-25-0-1_S25_L001_R1_001.fastq.gz"
[51] "LFGCM-8276-25-0-1_S25_L001_R2_001.fastq.gz" "LFGCM-8276-26-0-1_S26_L001_R1_001.fastq.gz"
[53] "LFGCM-8276-26-0-1_S26_L001_R2_001.fastq.gz" "LFGCM-8276-27-0-1_S27_L001_R1_001.fastq.gz"
[55] "LFGCM-8276-27-0-1_S27_L001_R2_001.fastq.gz" "LFGCM-8276-28-0-1_S28_L001_R1_001.fastq.gz"
[57] "LFGCM-8276-28-0-1_S28_L001_R2_001.fastq.gz" "LFGCM-8276-29-0-1_S29_L001_R1_001.fastq.gz"
[59] "LFGCM-8276-29-0-1_S29_L001_R2_001.fastq.gz" "LFGCM-8276-30-0-1_S30_L001_R1_001.fastq.gz"
[61] "LFGCM-8276-30-0-1_S30_L001_R2_001.fastq.gz" "LFGCM-8276-31-0-1_S31_L001_R1_001.fastq.gz"
[63] "LFGCM-8276-31-0-1_S31_L001_R2_001.fastq.gz" "LFGCM-8276-32-0-1_S32_L001_R1_001.fastq.gz"
[65] "LFGCM-8276-32-0-1_S32_L001_R2_001.fastq.gz" "LFGCM-8276-33-0-1_S33_L001_R1_001.fastq.gz"
[67] "LFGCM-8276-33-0-1_S33_L001_R2_001.fastq.gz" "LFGCM-8276-34-0-1_S34_L001_R1_001.fastq.gz"
[69] "LFGCM-8276-34-0-1_S34_L001_R2_001.fastq.gz" "LFGCM-8276-35-0-1_S35_L001_R1_001.fastq.gz"
[71] "LFGCM-8276-35-0-1_S35_L001_R2_001.fastq.gz" "LFGCM-8276-36-0-1_S36_L001_R1_001.fastq.gz"
[73] "LFGCM-8276-36-0-1_S36_L001_R2_001.fastq.gz" "LFGCM-8276-37-0-1_S37_L001_R1_001.fastq.gz"
[75] "LFGCM-8276-37-0-1_S37_L001_R2_001.fastq.gz" "LFGCM-8276-38-0-1_S38_L001_R1_001.fastq.gz"
[77] "LFGCM-8276-38-0-1_S38_L001_R2_001.fastq.gz" "LFGCM-8276-39-0-1_S39_L001_R1_001.fastq.gz"
[79] "LFGCM-8276-39-0-1_S39_L001_R2_001.fastq.gz" "LFGCM-8276-40-0-1_S40_L001_R1_001.fastq.gz"
[81] "LFGCM-8276-40-0-1_S40_L001_R2_001.fastq.gz" "Mock_S280_L001_R1_001.fastq"               
[83] "Mock_S280_L001_R2_001.fastq"                "mouse.dpw.metadata"                        
[85] "mouse.time.design"                          "primerfiltered"                            
[87] "silva_nr_v128_train_set.fa.gz"              "stability.batch"                           
[89] "stability.files"                           
> fnFs <- sort(list.files(path, pattern="_R1_001.fastq", full.names = TRUE))
> fnRs <- sort(list.files(path, pattern="_R2_001.fastq", full.names = TRUE))
> # Extract sample names, assuming filenames have format: SAMPLENAME_XXX.fastq
> sample.names <- sapply(strsplit(basename(fnFs), "_"), `[`, 1)
> filtFs <- file.path(path, "filtered", paste0(sample.names, "_F_filt.fastq.gz"))
> filtRs <- file.path(path, "filtered", paste0(sample.names, "_R_filt.fastq.gz"))
> 
> 
> 
> 
> 
> out <- filterAndTrim(fnFs, filtFs, fnRs, filtRs, truncLen=c(200, 200), trimLeft=c(19, 20), maxN=0, maxEE=c(2, 2), truncQ=2,
+                      
+                      rm.phix=TRUE, compress=TRUE, multithread=FALSE)
Creating output directory: C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/filtered
> 
> head(out)
                                          reads.in reads.out
LFGCM-8276-01-0-1_S1_L001_R1_001.fastq.gz   195778     50036
LFGCM-8276-02-0-1_S2_L001_R1_001.fastq.gz   257943     64930
LFGCM-8276-03-0-1_S3_L001_R1_001.fastq.gz   186674     47056
LFGCM-8276-04-0-1_S4_L001_R1_001.fastq.gz   252689     65418
LFGCM-8276-05-0-1_S5_L001_R1_001.fastq.gz   203296     51117
LFGCM-8276-06-0-1_S6_L001_R1_001.fastq.gz   153113     38681
> track <- cbind(out, sapply(dadaFs, getN), sapply(dadaRs, getN), sapply(mergers, getN), rowSums(seqtab.nochim))
Warning message:
In cbind(out, sapply(dadaFs, getN), sapply(dadaRs, getN), sapply(mergers,  :
  number of rows of result is not a multiple of vector length (arg 2)
> colnames(track) <- c("input", "filtered", "denoisedF", "denoisedR", "merged", "nonchim")
> rownames(track) <- sample.names
> head(track)
                   input filtered denoisedF denoisedR merged nonchim
LFGCM-8276-01-0-1 195778    50036     49227     49270  48198   48078
LFGCM-8276-02-0-1 257943    64930     63729     63731  62082   60944
LFGCM-8276-03-0-1 186674    47056     46183     46366  45018   44675
LFGCM-8276-04-0-1 252689    65418     64247     64087  60765   58927
LFGCM-8276-05-0-1 203296    51117     50285     50364  48912   48911
LFGCM-8276-06-0-1 153113    38681     38033     38082  37027   36932
> taxa.print <- taxa # Removing sequence rownames for display only
Error: object 'taxa' not found
> taxa <- assignTaxonomy(seqtab.nochim, "C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/silva_nr_v128_train_set.fa.gz", multithread=TRUE)
> 
> taxa.print <- taxa # Removing sequence rownames for display only
> rownames(taxa.print) <- NULL
> head(taxa.print)
     Kingdom    Phylum           Class                Order              Family             
[1,] "Bacteria" "Proteobacteria" "Betaproteobacteria" "Burkholderiales"  "Comamonadaceae"   
[2,] "Bacteria" "Actinobacteria" "Actinobacteria"     "Micrococcales"    "Microbacteriaceae"
[3,] "Bacteria" "Actinobacteria" "Actinobacteria"     "Frankiales"       "Sporichthyaceae"  
[4,] "Bacteria" "Cyanobacteria"  "Chloroplast"        NA                 NA                 
[5,] "Bacteria" "Bacteroidetes"  "Flavobacteriia"     "Flavobacteriales" "Flavobacteriaceae"
[6,] "Bacteria" "Bacteroidetes"  "Flavobacteriia"     "Flavobacteriales" "Cryomorphaceae"   
     Genus                 
[1,] NA                    
[2,] "Candidatus_Limnoluna"
[3,] "hgcI_clade"          
[4,] NA                    
[5,] "Flavobacterium"      
[6,] NA                    
> save(list = ls(all.names = TRUE), file = "C:/Users/radhi/Desktop/onefolder_1_to_40_FASTQ_Generation/variables.RData")
> unqs.mock <- seqtab.nochim["Mock",]
Error in seqtab.nochim["Mock", ] : subscript out of bounds
> library(phyloseq); packageVersion("phyloseq")
[1] ‘1.46.0’
> library(ggplot2); packageVersion("ggplot2")
[1] ‘3.4.4’
> theme_set(theme_bw())
> samples.out <- rownames(seqtab.nochim)
> subject <- sapply(strsplit(samples.out, "D"), `[`, 1)
> gender <- substr(subject, 1, 1)
> subject <- substr(subject, 2, 999)
> day <- as.integer(sapply(strsplit(samples.out, "D"), `[`, 2))
> samdf <- data.frame(Subject = subject, Gender = gender, Day = day)
> samdf$When <- "Early"
> samdf$When[samdf$Day > 100] <- "Late"
> # Create unique row names using paste0 and row numbers
> unique_row_names <- paste0(samples.out, "_", seq_len(nrow(samdf)))
> rownames(samdf) <- unique_row_names
> ps <- phyloseq(otu_table(seqtab.nochim, taxa_are_rows=FALSE), 
+                sample_data(samdf), 
+                tax_table(taxa))
Error in validObject(.Object) : invalid class “phyloseq” object: 
 Component sample names do not match.
 Try sample_names()
> ps <- phyloseq(otu_table(seqtab.nochim, taxa_are_rows=FALSE), 
+                sample_data(samdf), 
+                tax_table(taxa))
Error in validObject(.Object) : invalid class “phyloseq” object: 
 Component sample names do not match.
 Try sample_names()
> ps <- prune_samples(sample_names(ps) != "Mock", ps) # Remove mock sample
Error in h(simpleError(msg, call)) : 
  error in evaluating the argument 'samples' in selecting a method for function 'prune_samples': error in evaluating the argument 'physeq' in selecting a method for function 'sample_names': object 'ps' not found
> ps <- sample_names(otu_table(seqtab.nochim, taxa_are_rows=FALSE), 
+                sample_data(samdf), 
+                tax_table(taxa))
Error in sample_names(otu_table(seqtab.nochim, taxa_are_rows = FALSE),  : 
  unused arguments (sample_data(samdf), tax_table(taxa))
> table(nchar(getSequences(seqtab)))

 202  203  205  215  219  220  221  229  242  244  247  248  251  252  253  254  255  256  257  261  271  272 
  73    1    1    1    1    1    2    1    1    1    1    1    4  162 5373  392   41    8    6    1    1    1 
 282  285  288  289  292  299  309  336 
   1    2    1    1    1    1    2    1 
> dim(seqtab.nochim)
[1]   40 5457
> load
function (file, envir = parent.frame(), verbose = FALSE) 
{
    if (is.character(file)) {
        con <- gzfile(file)
        on.exit(close(con))
        magic <- readChar(con, 5L, useBytes = TRUE)
        if (!length(magic)) 
            stop("empty (zero-byte) input file")
        if (!grepl("RD[ABX][2-9]\n", magic)) {
            if (grepl("RD[ABX][2-9]\r", magic)) 
                stop("input has been corrupted, with LF replaced by CR")
            warning(sprintf("file %s has magic number '%s'\n", 
                sQuote(basename(file)), gsub("[\n\r]*", "", magic)), 
                "  ", "Use of save versions prior to 2 is deprecated", 
                domain = NA, call. = FALSE)
            return(.Internal(load(file, envir)))
        }
    }
    else if (inherits(file, "connection")) {
        con <- if (inherits(file, "gzfile") || inherits(file, 
            "gzcon")) 
            file
        else gzcon(file)
    }
    else stop("bad 'file' argument")
    if (verbose) 
        cat("Loading objects:\n")
    .Internal(loadFromConn2(con, envir, verbose))
}
<bytecode: 0x0000021d5bde00b0>
<environment: namespace:base>
> sample_names()
NULL
> samples.out
 [1] "LFGCM-8276-01-0-1" NA                  NA                  NA                  NA                 
 [6] NA                  NA                  NA                  NA                  NA                 
[11] NA                  NA                  NA                  NA                  NA                 
[16] NA                  NA                  NA                  NA                  NA                 
[21] NA                  NA                  NA                  NA                  NA                 
[26] NA                  NA                  NA                  NA                  NA                 
[31] NA                  NA                  NA                  NA                  NA                 
[36] NA                  NA                  NA                  NA                  NA                 
> dim(seqtab.nochim)
[1]   40 5457
> sum(seqtab.nochim)/sum(seqtab)
[1] 0.9916625
> head(track)
                   input filtered denoisedF denoisedR merged nonchim
LFGCM-8276-01-0-1 195778    50036     49227     49270  48198   48078
LFGCM-8276-02-0-1 257943    64930     63729     63731  62082   60944
LFGCM-8276-03-0-1 186674    47056     46183     46366  45018   44675
LFGCM-8276-04-0-1 252689    65418     64247     64087  60765   58927
LFGCM-8276-05-0-1 203296    51117     50285     50364  48912   48911
LFGCM-8276-06-0-1 153113    38681     38033     38082  37027   36932
> cat("DADA2 inferred", length(unqs.mock), "sample sequences present in the Mock community.\n")
Error: object 'unqs.mock' not found
> rownames(seqtab.nochim)
 [1] "LFGCM-8276-01-0-1" NA                  NA                  NA                  NA                 
 [6] NA                  NA                  NA                  NA                  NA                 
[11] NA                  NA                  NA                  NA                  NA                 
[16] NA                  NA                  NA                  NA                  NA                 
[21] NA                  NA                  NA                  NA                  NA                 
[26] NA                  NA                  NA                  NA                  NA                 
[31] NA                  NA                  NA                  NA                  NA                 
[36] NA                  NA                  NA                  NA                  NA

Here are my files in their folder: Screenshot (58)

nush320 commented 3 months ago

Hi, how did you solve this issue? I am trying to figure out.