search

benjjneb / dada2

Accurate sample inference from amplicon data with single nucleotide resolution
http://benjjneb.github.io/dada2/
GNU Lesser General Public License v3.0
470 stars 142 forks source link

error regarding addSpecies and assignSpecies command in DADA2 #1979

Open abhisek061github opened 4 months ago

abhisek061github commented 4 months ago

I am facing a problem with addSpecies and assignSpecies both commands in DADA2. I didn't get any species-level information for our data. I followed your standard pipeline (https://benjjneb.github.io/dada2/tutorial_1_8.html). I used trimmed 16s data from fastp for my analysis. I used tryRC = TRUE but also didn't work, allowMultiple = FALSE, but also didn't work. I get assigned up to genus level with assignTaxonomy command but with addSpecies or assignSpecies commands I couldn't add species-level information. My commands are the following - Please help me to fix this.

taxa <- assignSpecies(taxa, refFasta = "/home/omic/Downloads/Final_analysis/fasta_files/rdp_species_assignment_18.fa.gz", allowMultiple = FALSE, tryRC = FALSE, n = 2000, verbose = TRUE )

taxa <- addSpecies(taxa, refFasta = "/home/omic/Downloads/Final_analysis/fasta_files/rdp_species_assignment_18.fa.gz", allowMultiple = FALSE, tryRC = FALSE, n = 2000, verbose = TRUE)

I tried silva and RDP both species databases for species assignment getting such error. Do you know how I can fix this?

0 out of 712 were assigned to the species level. Of which 0 had genera consistent with the input table.

benjjneb commented 4 months ago

Could you provide a little more information on your sequencing data? What kind of environment and what locus/primer-set are you sequencing? Could you provide some example sequences that are not getting assigned, maybe 3 random sequences from your 712?

abhisek061github commented 4 months ago

Hi, Thank you for your kind responses. I have two primer sequences for sequencing 16s data.. Primer sequences are in 5' --> 3' orientation.

  1. CCTACGGGNGGCWGCAG
  2. GACTACHVGGGTATCTAATCC and I have two adapter
  3. P7 adapter read1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
  4. P5 adapter read2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT I have tried to trim those adaptor sequences with the help of fastp and now I am trying to remove those primer sequences with cutadapt. If anybody knows which command is best for me to remove those primers from my data, please let me know. Thanks. I hope my problem will solve when I trim the primmer.

[3' adapter] -a ADAPTER

[5' adapter] -g ADAPTER

[Anchored 3' adapter] -a ADAPTER$

[Anchored 5' adapter]-g ^ADAPTER

[5' or 3' (both possible)] -b ADAPTER

abhisek061github commented 4 months ago

my problem is solved when I trimmed primer sequences with filterAndTrim command in DADA2 thanks. I trimmed 20 based on the starting and end positions of the reads. Thanks.