search

bihealth / reev

REEV: Explanation and Evaluation of Variants
MIT License
7 stars 2 forks source link

Properly implement computer-aided ACMG assessment for sequence variants. #123

Open holtgrewe opened 9 months ago

holtgrewe commented 9 months ago

Is your feature request related to a problem? Please describe. The current intervar is not up to date.

Describe the solution you'd like

Describe alternatives you've considered N/A

Additional context

holtgrewe commented 9 months ago

ACMG: PM2-supporting (absent from gnomAD) missing

genomic variant [hg19/GRCh37] gene RefSeq transcript variant effect variant class inheritance ACMG-class (criteria)
chr3:46940358:C:A PTH1R NM_000316.3 c.834+11C>A;p.? splice site ? class III - uncertain significance (PM2-supporting)

image

holtgrewe commented 9 months ago

ACMG: PP3 not in combination with PVS1, PM2 on supporting level only

genomic variant [hg19/GRCh37] gene RefSeq transcript variant effect variant class inheritance ACMG-class (criteria) ClinVar ID
chr2:219747090:C:A WNT10A NM_025216.3 c.321C>A;p.(Cys107*) nonsense maternal class V - pathogenic (PVS1-very strong, PM2-supporting, PP4-supporting, PP5-strong) VCV000004461.40

image

holtgrewe commented 9 months ago

No ACMG Rating

genomic variant [hg19/GRCh37] gene RefSeq transcript variant effect variant class inheritance ACMG-class (criteria) ClinVar ID
chr4:111539501:AAG:G PITX2 NM_000325.6 c.754_755del;p.(Leu252Glufs*5) frameshift paternal class V - pathogenic (PVS1-very strong, PS4-moderate, PM3-moderate, PP4-supporting) none

image

Automated should be: PVS1- strong (not subject to NMD but >10% of protein), PM2-supporting

image

holtgrewe commented 9 months ago

No ACMG Rating

genomic variant [hg19/GRCh37] gene RefSeq transcript variant effect variant class inheritance ACMG-class (criteria) ClinVar ID
chr4:113568536:G:GA LARP7 NM_001267039.1 c.855dup, p.(R286Tfs*5) frameshift paternal class V - pathogenic (PVS1-very strong, PS4-moderate, PM3-moderate, PP4-supporting) SCV002578131.1

Automated should be: PVS1-very strong, PS4-supporting or moderate or old: PP5, PM2-supporting

holtgrewe commented 9 months ago
genomic variant [hg19/GRCh37] gene RefSeq transcript variant effect variant class inheritance ACMG-class (criteria) ClinVar ID
chr4:113568635:ATCAAAAGTAAAGAAAATTAT:A LARP7 NM_001267039.1 c.952_971del, p.(V319Rfs*4) frameshift maternal class V - pathogenic (PVS1-very strong, PS4-moderate, PM3-moderate, PP4-supporting) SCV002578133.1

class V - pathogenic (PVS1-very strong, PS4-moderate, PM3-moderate, PP4-supporting)

holtgrewe commented 9 months ago

ACMG: correct, but PP3 should not be used, PS3/PP5 missing (see below)

genomic variant [hg19/GRCh37] gene RefSeq transcript variant effect variant class inheritance ACMG-class (criteria) ClinVar ID
chr7:94034532:C:T COL1A2 NM_000089.3 c.454C>T, p.(R152*) nonsense ? class V – pathogenic (PVS1-very strong, PM2-supporting, PS3-supporting VCV001451204.3

Automated should be: PVS1-very strong, PS4-supporting or moderate or old: PP5, PM2-supporting

image