ClinVar entry missing for variants

[holtgrewe]

Describe the bug ClinVar information is missing for variants.

To Reproduce Steps to reproduce the behavior:

1. Go to variant https://reev.cubi.bihealth.org/variant/chr2:219747090:C:A/grch37
2. Scroll down to clinvar box
3. See missing data

Expected behavior REEV should redirect to VCV000004461.40 https://www.ncbi.nlm.nih.gov/clinvar/variation/4461

Screenshots

Additional context genomic variant [hg19/GRCh37]	gene	RefSeq transcript	variant effect	variant class	inheritance	ACMG-class (criteria)	ClinVar ID
chr2:219747090:C:A	WNT10A	NM_025216.3	c.321C>A;p.(Cys107*)	nonsense	maternal	class V - pathogenic (PVS1-very strong, PM2-supporting, PP4-supporting, PP5-strong)	VCV000004461.40

[holtgrewe]

chr4:113568536:G:GA

[holtgrewe]

chr4:113568635:ATCAAAAGTAAAGAAAATTAT:A

[holtgrewe]

Hm, for the first one we have the following JSON returned by the annonars service:

{
    "clinvar": {
        "release": "GRCh37",
        "chromosome": "2",
        "start": 219747090,
        "stop": 219747090,
        "reference": "C",
        "alternative": "A",
        "rcv": "RCV002247247",
        "clinical_significance": 0,
        "review_status": 3
    }
}

For the second we have:

{
    "clinvar": {
        "release": "GRCh37",
        "chromosome": "4",
        "start": 113568536,
        "stop": 113568537,
        "reference": "G",
        "alternative": "GA",
        "rcv": "RCV001262130",
        "clinical_significance": 0,
        "review_status": 4
    }
}

The third is indeed missing.

[holtgrewe]

@gromdimon please look into the issue as the first two variants should appear

[holtgrewe]

Actually, the last variant is chr4:113568636:ATCAAAAGTAAAGAAAATTAT:A so the position was shifted in my comment.

So the URL for this in reev is:

https://reev.cubi.bihealth.org/internal/proxy/annonars/annos/variant?genome_release=grch37&chromosome=4&pos=113568636&reference=ATCAAAAGTAAAGAAAATTAT&alternative=A

and the result is

{
    "clinvar": {
        "release": "GRCh37",
        "chromosome": "4",
        "start": 113568636,
        "stop": 113568655,
        "reference": "ATCAAAAGTAAAGAAAATTAT",
        "alternative": "A",
        "rcv": "RCV002287861",
        "clinical_significance": 0,
        "review_status": 3
    }
}

[holtgrewe]

@gromdimon I think this is only an issue in our Vue front-end code and one fix should fix all issues.