Error message after installing biopieces

[GoogleCodeExporter]

I tried to install biopieces using biopieces_installer.sh and at the end I 
received the following error message (after running the Biopieces testsuite):

./biopieces_installer.sh: line 465: /bp_test/test_all: No such file or directory

Here is a copy of the full output:

Checking for existing Biopieces installation:
Continue (yes/no)? yes
Testing prerequisites:
   Testing subversion client - "svn": OK
   Testing Perl version: OK
   Testing required Perl module - "Inline": OK
   Testing required Perl module - "JSON::XS": OK
   Testing required Perl module - "SVG": OK
   Testing required Perl module - "Bit::Vector": OK
   Testing required Perl module - "Time::HiRes": OK
   Testing Ruby version: OK
   Testing required Ruby gem - "gnuplot": OK
   Testing required Ruby gem - "narray": OK
   Testing auxiliary program - "blastall": OK
   Testing auxiliary program - "blat": WARNING
   Testing auxiliary program - "bwa": WARNING
   Testing auxiliary program - "bowtie": OK
   Testing auxiliary program - "formatdb": OK
   Testing auxiliary program - "gnuplot": OK
   Testing auxiliary program - "idba": WARNING
   Testing auxiliary program - "muscle": OK
   Testing auxiliary program - "mummer": OK
   Testing auxiliary program - "mysql": OK
   Testing auxiliary program - "prodigal": WARNING
   Testing auxiliary program - "Ray": WARNING
   Testing auxiliary program - "scan_for_matches": WARNING
   Testing auxiliary program - "uclust": WARNING
   Testing auxiliary program - "velveth": OK
   Testing auxiliary program - "velvetg": OK
   Testing auxiliary program - "vmatch": WARNING

   Any WARNINGs indicate that the executable for that auxillary
   program could not be found. While not critical, this will
   cause some Biopieces to fail.
Continue (yes/no)? yes
Enter directory to install Biopieces code (default: /home/manager/biopieces): 
Enter directory to install Biopieces data (default: /home/manager/BP_DATA): 
Enter directory to install Biopieces log (default: /var/log): 
Enter directory to install Biopieces tmp (default: /tmp): 
Downloading Biopieces code from repository: OK
Downloading Biopieces wiki from repository: OK

We need to append the below section to your .bashrc file.

# >>>>>>>>>>>>>>>>>>>>>>> Enabling Biopieces <<<<<<<<<<<<<<<<<<<<<<<

export BP_DIR="/home/manager/biopieces"
export BP_DATA="/home/manager/BP_DATA"
export BP_TMP="/tmp"
export BP_LOG="/var/log"

source "$BP_DIR/bp_conf/bashrc"

# >>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<

Append (yes/no/abort)? yes
Appending /home/manager/.bashrc: OK

   Backup is /home/manager/.bashrc_biopieces
Running the Biopieces test suite:

./biopieces_installer.sh: line 465: /bp_test/test_all: No such file or directory

   Any FAIL indicates broken Biopieces - seek help!
Continue (yes/no)?

I tried to install it on Bio-Linux 6 (Ubuntu 10.04 LTS). Any idea what might 
have gone wrong?

Many thanks,
Ronny

Original issue reported on code.google.com by ronny.va...@googlemail.com on 21 Oct 2011 at 10:51

[GoogleCodeExporter]

Can you confirm that the .bashrc file was appended?

Original comment by martinah...@gmail.com on 22 Oct 2011 at 6:47

[GoogleCodeExporter]

I uploaded an improved installer (biopieces_installer-0.3.sh) which has 
improved checks on the appending of the .bashrc. This might give some better 
clues on the problem, so try this instead of the old one.

Original comment by martinah...@gmail.com on 22 Oct 2011 at 8:11

[GoogleCodeExporter]

Thanks for your speedy replies! I ran the new biopieces installer and it was 
properly appended. However, I got the same error message.

I then located the read_fastq file in the bp_bin folder and tried the following:

[bp_bin] ./read_fastq

<internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- 
maasha/biopieces (LoadError)
    from <internal:lib/rubygems/custom_require>:29:in `require'
    from ./read_fastq:31:in `<main>'

[bp_bin] ./read_fastq -?

zsh: no matches found: -?

Any suggestions would be highly appreciated!

Original comment by ronny.va...@googlemail.com on 22 Oct 2011 at 12:37

[GoogleCodeExporter]

It appears you are running zsh. Biopieces only run under bash. Try typing bash 
on the command line and then bp_test.

Original comment by martinah...@gmail.com on 22 Oct 2011 at 12:49

[GoogleCodeExporter]

Fantastic! It's working now, but there were a few fails (see below). Is this 
because I don't have all the pre-requisites installed (e.g. vmatch, etc.)?

Biopieces tested: 68  Tests run: 201  OK: 182  FAIL: 11  WARNING: 8  Time: 151 
secs

Testing find_adaptor -a TCGTATGCCGTCTTCTGCTTG -m 0 -i 0 -d 0 -I 
$BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/manager.find_adaptor.out ... FAIL
Testing find_adaptor -a TCGTATGCCGTCTTCTGCTTG -m 0 -i 0 -d 0 -p -l 5 -I 
$BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/manager.find_adaptor.out ... FAIL
Testing find_adaptor -a TCGTATGCCGTCTTCTGCTTG -m 10 -i 0 -d 0 -I 
$BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/manager.find_adaptor.out ... FAIL
Testing find_adaptor -a TCGTATGCCGTCTTCTGCTTG -m 0 -i 10 -d 0 -I 
$BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/manager.find_adaptor.out ... FAIL
Testing find_adaptor -a TCGTATGCCGTCTTCTGCTTG -m 0 -i 0 -d 10 -I 
$BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/manager.find_adaptor.out ... FAIL
Testing patscan_seq -I $BP_DIR/bp_test/in/patscan_seq.in.1 -p GACT -O 
$BP_TMP/manager.patscan_seq.out ... FAIL
Testing patscan_seq -I $BP_DIR/bp_test/in/patscan_seq.in.1 -p GACT -c -O 
$BP_TMP/manager.patscan_seq.out ... FAIL
Testing patscan_seq -I $BP_DIR/bp_test/in/patscan_seq.in.1 -p GACT -i -O 
$BP_TMP/manager.patscan_seq.out ... FAIL
Testing patscan_seq -I $BP_DIR/bp_test/in/patscan_seq.in.2 -p RARP -O 
$BP_TMP/manager.patscan_seq.out ... FAIL
Testing patscan_seq -I $BP_DIR/bp_test/in/patscan_seq.in.2 -p RARP -i -O 
$BP_TMP/manager.patscan_seq.out ... FAIL
Testing plot_distribution -k SEQ_LEN -I $BP_DIR/bp_test/in/plot_distribution.in 
-o $BP_TMP/manager.plot_distribution.out -x ... FAIL

Many thanks for your help!

Original comment by ronny.va...@googlemail.com on 22 Oct 2011 at 12:59

[GoogleCodeExporter]

FAILs are due to missing prerequisites (see WARNINGS). find_adaptor and 
patscan_seq requires scan_for_matches which is available at the download page. 
plot_distribution requires gnuplot (and the right version that correctly prints 
the y-axis label using dumb terminal). vmatch_seq requires vmatch etc.

Original comment by martinah...@gmail.com on 22 Oct 2011 at 1:15

• Changed state: Fixed