search

bioinform / somaticseq

An ensemble approach to accurately detect somatic mutations using SomaticSeq
http://bioinform.github.io/somaticseq/
BSD 2-Clause "Simplified" License
193 stars 53 forks source link

some indels had frequency of zero. #135

Open zenghp365 opened 3 months ago

zenghp365 commented 3 months ago

when I run somaticseq "--run-mutect2 --run-vardict --run-lofreq --run-scalpel --run-strelka2 --run-somaticseq --run-workflow ", I found some indels had frequency of zero. For example,

chr1 156842000 . A AAGAAAACTGATGTAAAGTAG 0.0 REJECT MDLPK=1,0,0,0,0;NUM_TOOLS=1;LC=11.5;AF=0 GT:DP4:CD4:refMQ:altMQ:refBQ:altBQ:refNM:altNM:fetSB:fetCD:uMQ:uBQ:MQ0:VAF 0/0:258,267,0,0:501,24,0,0:59.8762:.:34.4876:.:0.12:.:1.00:1.00:.:.:0:0

and this mutant was detected by Mutect2 with a normal frequency as following,

chr1 156842000 . A AAGAAAACTGATGTAAAGTAG . PASS AS_FilterStatus=SITE;AS_SB_TABLE=254,268|2,8;DP=532;ECNT=2;GERMQ=93;MBQ=20,35;MFRL=185,155;MMQ=60,60;MPOS=13;POPAF=7.30;TLOD=22.44 GT:AD:AF:DP:F1R2:F2R1:FAD:PGT:PID:PS:SB 0|1:522,10:0.029:532:138,2:132,4:376,10:0|1:156841998_T_TTTAAAATATATATATTTTTTGCACATTTCTATGTATATTTCACAATAAAA:156841998:254,268,2,8

So, I wonder if this mutation can output a normal frequency like mutect2 ?

litaifang commented 3 months ago

MuTect2 does local assembly and realignment, whereas the VAF is a simple counting of the reads in the original bam file that support this variant call. So it's entirely possible that MuTect2 can detect an indel after reassembly that's not apparent in the original alignment.

zenghp365 commented 3 months ago

Thanks for your quick reply! Yes, I understand. But it will bring a lot of trouble to our use, and it is highly recommended that this problem be resolved.