Open acuadros1 opened 4 years ago
Hi, could you drop me some fasta/fastq files (or parts of it)?
Best, Jan
Hi Jan,
I have it working now I just started from read counts instead.
Best, Alex Cuadros
On 21 May 2020, at 17:15, Jan Winter notifications@github.com wrote:
Hi, could you drop me some fasta/fastq files (or parts of it)?
Best, Jan
— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHubhttps://github.com/boutroslab/CRISPRAnalyzeR/issues/62#issuecomment-632142471, or unsubscribehttps://github.com/notifications/unsubscribe-auth/APTOBY6OCHG4CN2TVDKBFGLRSVAOTANCNFSM4NDDEZ4Q.
[ { "@context": "http://schema.org", "@type": "EmailMessage", "potentialAction": { "@type": "ViewAction", "target": "https://github.com/boutroslab/CRISPRAnalyzeR/issues/62#issuecomment-632142471", "url": "https://github.com/boutroslab/CRISPRAnalyzeR/issues/62#issuecomment-632142471", "name": "View Issue" }, "description": "View this Issue on GitHub", "publisher": { "@type": "Organization", "name": "GitHub", "url": "https://github.com" } } ]
Hi,
Thanks for the package, but I have the same problem here. Using four fastq files (~1GB each) didn´t pass the first step. If I upload only two, it works on the first step but it stops on 9% on the the "Check Gene and sgRNA Readcount for consistency".
It is running for 4 hours and there is no error message, though.
Best,
I have been trying for the past 2 days to troubleshoot an issue with the analysis tool. It is constantly stuck at 91% and "generating Fastq quality report" for several hours. I uploaded a cutom Fasta file for a subpool library made. The format for the entries are genename_seq (i.e. Tim20GACCATCGTGACTGGATCGT) so I input the custom regular expression: ^(.+?)(.*)$ My raw data was uploaded as fastq.gz compressed files. The vector used was a lentiguide Puro and all my sequences have the "CACCG-20nt sgRNA-GTTTT" motif. Since the default LGPuro regular expressions are ACC(.{20,21})G I have used a custom expression: ACCG(.{20})G Still the program hangs at 91% for several hours. Any fixes for this you have experienced? Thanks in advance.