Open lebolo opened 8 years ago
What is trimmed.cache
? Is that a proper datasource dir?
Also, are you sure that your VCF is valid at this mutation? It looks like it has spaces in it...
trimmed.cache
is a proper datasource directory. If I remove the caching option, Oncotator successfully runs through the whole VCF using this configuration. The spaces are an artifact of my copy-pasting, it's a valid VCF throughout.
I'm using oncotator v1.9.0.0 and am trying to speed up the process by creating a file cache for subsequent VCF to MAF processing. I get the error pasted below. I think the problem is that Linux has a filename length limit of 255 characters and the filename for this mutation is 299 characters. Before this mutation, the longest filename I see is 255 characters:
12_57870602_57870602_GGAGGGGGGGCAGGGAGGATCTTGGCCTTCACAAAGAAATGGGAGATTCACATGGGGGTCGTCCAGGAGCTGCGGCAGAGGTCGAGGGGCCTGCAAGGCT_AGCCTTGCAGGCCCCTCGACCTCTGCCGCAGCTCCTGGACGACCCCCATGTGAATCTCCCATTTCTTTGTGAAGGCCAAGATCCTCCCTGCCCCCCCTCC_16348fb8e83ab2e686dfc2a90986f498
.Any thoughts on how I can fix this without modifying oncotator code?
Just in case, this is what my command line looks like:
Error