Closed ghost closed 2 years ago
Can you provide the bash code and the completed error report?
Hi, here are the bash code and error report, thanks!
(MeRIPseqPipe) bash:$
nextflow run MeRIPseqPipe/ -profile test,docker N E X T F L O W ~ version 21.10.6 Launching
MeRIPseqPipe/main.nf
[clever_curran] - revision: 35281af540 ▄▄▄▄▄▄▄▄▄▄▄ ▄ ▄ ▄▄▄▄▄▄▄▄▄▄▄ ▄ ▄ ▄▄▄▄▄▄▄▄▄▄▄ ▄▄▄▄▄▄▄▄▄▄▄ ▐░░░░░░░░░░░▌▐░▌ ▐░▌▐░░░░░░░░░░░▌▐░▌ ▐░▌▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌ ▐░█▀▀▀▀▀▀▀▀▀ ▐░▌ ▐░▌▐░█▀▀▀▀▀▀▀▀▀ ▐░▌ ▐░▌▐░█▀▀▀▀▀▀▀▀▀ ▐░█▀▀▀▀▀▀▀▀▀ ▐░▌ ▐░▌ ▐░▌▐░▌ ▐░▌ ▐░▌▐░▌ ▐░▌
▐░█▄▄▄▄▄▄▄▄▄ ▐░█▄▄▄▄▄▄▄█░▌▐░█▄▄▄▄▄▄▄▄▄ ▐░▌ ▐░▌▐░▌ ▐░▌
▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌▐░▌ ▐░▌▐░▌ ▐░▌
▀▀▀▀▀▀▀▀▀█░▌ ▀▀▀▀█░█▀▀▀▀ ▀▀▀▀▀▀▀▀▀█░▌▐░▌ ▐░▌▐░▌ ▐░▌
▐░▌ ▐░▌ ▐░▌▐░▌ ▐░▌▐░▌ ▐░▌
▄▄▄▄▄▄▄▄▄█░▌ ▐░▌ ▄▄▄▄▄▄▄▄▄█░▌▐░█▄▄▄▄▄▄▄█░▌▐░█▄▄▄▄▄▄▄▄▄ ▐░█▄▄▄▄▄▄▄▄▄ ▐░░░░░░░░░░░▌ ▐░▌ ▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌ ▀▀▀▀▀▀▀▀▀▀▀ ▀ ▀▀▀▀▀▀▀▀▀▀▀ ▀▀▀▀▀▀▀▀▀▀▀ ▀▀▀▀▀▀▀▀▀▀▀ ▀▀▀▀▀▀▀▀▀▀▀ null ============You are running MeRIPseqPipe with the following parameters=============== Checking parameters ... ===================================Pipeline summary============================= Max Resources : 6 GB memory, 2 cpus, 2d time per job Container : docker - kingzhuky/meripseqpipe:dev Output dir : /data/dermatogenomics4/libingjie/m6a/MeRIPseqPipe/results Launch dir : /data/dermatogenomics4/libingjie/m6a Working dir : /data/dermatogenomics4/libingjie/m6a/work Script dir : /data/dermatogenomics4/libingjie/m6a/MeRIPseqPipe User : libingjie Config Profile : test,docker Config Description : Minimal test dataset to check pipeline function =====================================Reads types================================ SingleEnd : Single-End Stranded : no gzip : true ====================================Mode selected============================== aligners : star peakCalling_mode : independence peakMerged_mode : rank expression_analysis_mode : DESeq2 methylation_analysis_mode : QNB ==================================Input files selected========================== Reads Path : false fasta file : /data/dermatogenomics4/libingjie/m6a/MeRIPseqPipe/test_datasets/reference/TEST.fa Gtf file : /data/dermatogenomics4/libingjie/m6a/MeRIPseqPipe/test_datasets/reference/TEST.gtf Design file : /data/dermatogenomics4/libingjie/m6a/MeRIPseqPipe/test_datasets/inputfiles/designfile_single.tsv Compare file : /data/dermatogenomics4/libingjie/m6a/MeRIPseqPipe/test_datasets/inputfiles/comparefile.txt ==================================Skip model selected========================== Skip samtools sort : false Skip expression analysis : false Skip peakCalling : false Skip diffpeakCalling : false Skip annotation : false Skip qc : false executor > local (10) [3d/21600b] process > CheckDesignCompare [ 0%] 0 of 1 [ac/16506e] process > makeBED12 (gtf2bed12) [ 0%] 0 of 1 executor > local (10) [3d/21600b] process > CheckDesignCompare [ 0%] 0 of 1 [ac/16506e] process > makeBED12 (gtf2bed12) [ 0%] 0 of 1 [52/83324f] process > makechromesize (gtf2bed12) [ 0%] 0 of 1 [- ] process > MakeTophat2Index - executor > local (10) [3d/21600b] process > CheckDesignCompare [ 0%] 0 of 1 [ac/16506e] process > makeBED12 (gtf2bed12) [ 0%] 0 of 1 [52/83324f] process > makechromesize (gtf2bed12) [ 0%] 0 of 1 [- ] process > MakeTophat2Index - executor > local (11) [3d/21600b] process > CheckDesignCompare [ 0%] 0 of 1 [ac/16506e] process > makeBED12 (gtf2bed12) [ 0%] 0 of 1 [52/83324f] process > makechromesize (gtf2bed12) [ 0%] 0 of 1 [- ] process > MakeTophat2Index - [- ] process > MakeHisat2Index - [- ] process > MakeBWAIndex - [13/fafcae] process > MakeStarIndex (star_index) [ 0%] 0 of 1 [- ] process > MakerRNAindex - [ee/246c48] process > Fastp (control_1.input) [ 0%] 0 of 8 [- ] process > Fastqc - [- ] process > Tophat2Align - [- ] process > Hisat2Align - [- ] process > BWAAlign - [- ] process > StarAlign - [- ] process > SortRename - [- ] process > RSeQC - [- ] process > CreateBedgraph - [- ] process > multiqc - [- ] process > FeatureCount - [- ] process > DESeq2 - [- ] process > EdgeR - [- ] process > Metpeak - [- ] process > Macs2 - [- ] process > MATKpeakCalling - [- ] process > MeyerPrepration - [- ] process > Meyer - [- ] process > PeakMerge - [- ] process > BedAnnotated - [- ] process > MotifSearching - [- ] process > PeaksMotifReport - executor > local (11) [3d/21600b] process > CheckDesignCompare [ 0%] 0 of 1 [ac/16506e] process > makeBED12 (gtf2bed12) [100%] 1 of 1, failed: 1 ✘ [52/83324f] process > makechromesize (gtf2bed12) [ 0%] 0 of 1 [- ] process > MakeTophat2Index - [- ] process > MakeHisat2Index - [- ] process > MakeBWAIndex - [13/fafcae] process > MakeStarIndex (star_index) [ 0%] 0 of 1 [- ] process > MakerRNAindex - [33/9bdf86] process > Fastp (treated_1.ip) [ 12%] 1 of 8, failed: 1 [- ] process > Fastqc - [- ] process > Tophat2Align - [- ] process > Hisat2Align - [- ] process > BWAAlign - [- ] process > StarAlign - [- ] process > SortRename - [- ] process > RSeQC - [- ] process > CreateBedgraph - [- ] process > multiqc - [- ] process > FeatureCount - [- ] process > DESeq2 - [- ] process > EdgeR - [- ] process > Metpeak - [- ] process > Macs2 - [- ] process > MATKpeakCalling - [- ] process > MeyerPrepration - [- ] process > Meyer - [- ] process > PeakMerge - [- ] process > BedAnnotated - [- ] process > MotifSearching - [- ] process > PeaksMotifReport - [- ] process > PeaksQuantification - executor > local (11) [3d/21600b] process > CheckDesignCompare [100%] 1 of 1, failed: 1 ✘ [ac/16506e] process > makeBED12 (gtf2bed12) [100%] 1 of 1, failed: 1 ✘ [52/83324f] process > makechromesize (gtf2bed12) [100%] 1 of 1, failed: 1 ✘ [- ] process > MakeTophat2Index - [- ] process > MakeHisat2Index - [- ] process > MakeBWAIndex - [13/fafcae] process > MakeStarIndex (star_index) [100%] 1 of 1, failed: 1 ✘ [- ] process > MakerRNAindex - [97/a03ab5] process > Fastp (treated_2.input) [ 37%] 3 of 8, failed: 3 [- ] process > Fastqc - [- ] process > Tophat2Align - [- ] process > Hisat2Align - [- ] process > BWAAlign - [- ] process > StarAlign - [- ] process > SortRename - [- ] process > RSeQC - [- ] process > CreateBedgraph - [- ] process > multiqc - [- ] process > FeatureCount - [- ] process > DESeq2 - [- ] process > EdgeR - [- ] process > Metpeak - [- ] process > Macs2 - [- ] process > MATKpeakCalling - [- ] process > MeyerPrepration - [- ] process > Meyer - [- ] process > PeakMerge - [- ] process > BedAnnotated - [- ] process > MotifSearching - [- ] process > PeaksMotifReport - [- ] process > PeaksQuantification - executor > local (11) [3d/21600b] process > CheckDesignCompare [100%] 1 of 1, failed: 1 ✘ [ac/16506e] process > makeBED12 (gtf2bed12) [100%] 1 of 1, failed: 1 ✘ [52/83324f] process > makechromesize (gtf2bed12) [100%] 1 of 1, failed: 1 ✘ [- ] process > MakeTophat2Index - [- ] process > MakeHisat2Index - [- ] process > MakeBWAIndex - [13/fafcae] process > MakeStarIndex (star_index) [100%] 1 of 1, failed: 1 ✘ [- ] process > MakerRNAindex - [49/97324e] process > Fastp (treated_2.ip) [ 75%] 6 of 8, failed: 6 [- ] process > Fastqc - [- ] process > Tophat2Align - [- ] process > Hisat2Align - [- ] process > BWAAlign - [- ] process > StarAlign - [- ] process > SortRename - [- ] process > RSeQC - [- ] process > CreateBedgraph - [- ] process > multiqc - [- ] process > FeatureCount - [- ] process > DESeq2 - [- ] process > EdgeR - [- ] process > Metpeak - [- ] process > Macs2 - [- ] process > MATKpeakCalling - [- ] process > MeyerPrepration - [- ] process > Meyer - [- ] process > PeakMerge - [- ] process > BedAnnotated - [- ] process > MotifSearching - [- ] process > PeaksMotifReport - [- ] process > PeaksQuantification - [- ] process > diffm6APeak - executor > local (11) [3d/21600b] process > CheckDesignCompare [100%] 1 of 1, failed: 1 ✘ [ac/16506e] process > makeBED12 (gtf2bed12) [100%] 1 of 1, failed: 1 ✘ [52/83324f] process > makechromesize (gtf2bed12) [100%] 1 of 1, failed: 1 ✘ [- ] process > MakeTophat2Index - [- ] process > MakeHisat2Index - [- ] process > MakeBWAIndex - [13/fafcae] process > MakeStarIndex (star_index) [100%] 1 of 1, failed: 1 ✘ [- ] process > MakerRNAindex - [49/97324e] process > Fastp (treated_2.ip) [ 75%] 6 of 8, failed: 6 [- ] process > Fastqc - [- ] process > Tophat2Align - [- ] process > Hisat2Align - [- ] process > BWAAlign - [- ] process > StarAlign - [- ] process > SortRename - [- ] process > RSeQC - [- ] process > CreateBedgraph - [- ] process > multiqc - [- ] process > FeatureCount - [- ] process > DESeq2 - [- ] process > EdgeR - [- ] process > Metpeak - [- ] process > Macs2 - [- ] process > MATKpeakCalling - [- ] process > MeyerPrepration - [- ] process > Meyer - [- ] process > PeakMerge - [- ] process > BedAnnotated - [- ] process > MotifSearching - [- ] process > PeaksMotifReport - [- ] process > PeaksQuantification - [- ] process > diffm6APeak - [- ] process > SingleNucleotidePrediction - [- ] process > DiffReport - [- ] process > CreateIGVjs - [- ] process > get_software_versions [ 0%] 0 of 1 Execution cancelled -- Finishing pending tasks before exit WARN: There's no process matching config selector: fastp -- Did you mean: Fastp? WARN: There's no process matching config selector: sort Error executing process > 'makeBED12 (gtf2bed12)'
Caused by:
Process makeBED12 (gtf2bed12)
terminated with an error exit status (1)
Command executed:
gtf_file=TEST.gtf gtfToGenePred -genePredExt -geneNameAsName2 $gtf_file ${gtf_file/.gtf/.tmp} genePredToBed ${gtf_file/.gtf/.tmp} ${gtf_file/.gtf/.bed}
Command exit status: 1
Command output: (empty)
Command error: touch: cannot touch '.command.trace': Permission denied
Work dir: /data/dermatogenomics4/libingjie/m6a/work/ac/16506e78617d85361373a198bdcfe0
Tip: you can replicate the issue by changing to the process work dir and entering the command bash .command.run
Hi, 66zhuang! Do you have permissions to executed docker on that machine without specifying sudo? That is, have you added your user to the docker group?
Hi, 66zhuang! Do you have permissions to executed docker on that machine without specifying sudo? That is, have you added your user to the docker group?
Hi canceromics, Yes, I am already in the docker group. `$ groups dockerroot docker
$ docker run --rm hello-world | head -n2 Hello from Docker!`
Can you try adding
docker.runOptions = '-u $(id -u):$(id -g)'
to your nextflow.config file? It seems like a user permission error. (Check here for similar issue: assemblerflow/flowcraft#142)
Hi cnaceromics,
docker.runOptions = '-u $(id -u):$(id -g)'
is already in the MeRIPseqPipe/nextflow.config file (line105, line116).
Do I need to create a new nextflow.config file?
Hi, 66zhuang! You don't need to create a new nextflow.config file. Please wait moment. Another error may have occurred.
Hi, 66zhuang! Can you show me the .command.run file in /data/dermatogenomics4/libingjie/m6a/work/ac/16506e78617d85361373a198bdcfe0 ?
Hi, here are the .command.run file.
#!/bin/bash
# NEXTFLOW TASK: makeBED12 (gtf2bed12)
set -e
set -u
NXF_DEBUG=${NXF_DEBUG:=0}; [[ $NXF_DEBUG > 1 ]] && set -x
NXF_ENTRY=${1:-nxf_main}
nxf_tree() {
local pid=$1
declare -a ALL_CHILDREN
while read P PP;do
ALL_CHILDREN[$PP]+=" $P"
done < <(ps -e -o pid= -o ppid=)
pstat() {
local x_pid=$1
local STATUS=$(2> /dev/null < /proc/$1/status egrep 'Vm|ctxt')
if [ $? = 0 ]; then
local x_vsz=$(echo "$STATUS" | grep VmSize | awk '{print $2}' || echo -n '0')
local x_rss=$(echo "$STATUS" | grep VmRSS | awk '{print $2}' || echo -n '0')
local x_peak=$(echo "$STATUS" | egrep 'VmPeak|VmHWM' | sed 's/^.*:\s*//' | sed 's/[\sa-zA-Z]*$//' | tr '\n' ' ' || echo -n '0 0')
local x_pmem=$(awk -v rss=$x_rss -v mem_tot=$mem_tot 'BEGIN {printf "%.0f", rss/mem_tot*100*10}' || echo -n '0')
local vol_ctxt=$(echo "$STATUS" | grep '\bvoluntary_ctxt_switches' | awk '{print $2}' || echo -n '0')
local inv_ctxt=$(echo "$STATUS" | grep '\bnonvoluntary_ctxt_switches' | awk '{print $2}' || echo -n '0')
cpu_stat[x_pid]="$x_pid $x_pmem $x_vsz $x_rss $x_peak $vol_ctxt $inv_ctxt"
fi
}
pwalk() {
pstat $1
for i in ${ALL_CHILDREN[$1]:=}; do pwalk $i; done
}
pwalk $1
}
nxf_stat() {
cpu_stat=()
nxf_tree $1
declare -a sum=(0 0 0 0 0 0 0 0)
local pid
local i
for pid in "${!cpu_stat[@]}"; do
local row=(${cpu_stat[pid]})
[ $NXF_DEBUG = 1 ] && echo "++ stat mem=${row[*]}"
for i in "${!row[@]}"; do
if [ $i != 0 ]; then
sum[i]=$((sum[i]+row[i]))
fi
done
done
[ $NXF_DEBUG = 1 ] && echo -e "++ stat SUM=${sum[*]}"
for i in {1..7}; do
if [ ${sum[i]} -lt ${cpu_peak[i]} ]; then
sum[i]=${cpu_peak[i]}
else
cpu_peak[i]=${sum[i]}
fi
done
[ $NXF_DEBUG = 1 ] && echo -e "++ stat PEAK=${sum[*]}\n"
nxf_stat_ret=(${sum[*]})
}
nxf_mem_watch() {
set -o pipefail
local pid=$1
local trace_file=.command.trace
local count=0;
declare -a cpu_stat=(0 0 0 0 0 0 0 0)
declare -a cpu_peak=(0 0 0 0 0 0 0 0)
local mem_tot=$(< /proc/meminfo grep MemTotal | awk '{print $2}')
local timeout
local DONE
local STOP=''
[ $NXF_DEBUG = 1 ] && nxf_sleep 0.2 && ps fx
while true; do
nxf_stat $pid
if [ $count -lt 10 ]; then timeout=1;
elif [ $count -lt 120 ]; then timeout=5;
else timeout=30;
fi
read -t $timeout -r DONE || true
[[ $DONE ]] && break
if [ ! -e /proc/$pid ]; then
[ ! $STOP ] && STOP=$(nxf_date)
[ $(($(nxf_date)-STOP)) -gt 10000 ] && break
fi
count=$((count+1))
done
echo "%mem=${nxf_stat_ret[1]}" >> $trace_file
echo "vmem=${nxf_stat_ret[2]}" >> $trace_file
echo "rss=${nxf_stat_ret[3]}" >> $trace_file
echo "peak_vmem=${nxf_stat_ret[4]}" >> $trace_file
echo "peak_rss=${nxf_stat_ret[5]}" >> $trace_file
echo "vol_ctxt=${nxf_stat_ret[6]}" >> $trace_file
echo "inv_ctxt=${nxf_stat_ret[7]}" >> $trace_file
}
nxf_write_trace() {
echo "nextflow.trace/v2" > $trace_file
echo "realtime=$wall_time" >> $trace_file
echo "%cpu=$ucpu" >> $trace_file
echo "rchar=${io_stat1[0]}" >> $trace_file
echo "wchar=${io_stat1[1]}" >> $trace_file
echo "syscr=${io_stat1[2]}" >> $trace_file
echo "syscw=${io_stat1[3]}" >> $trace_file
echo "read_bytes=${io_stat1[4]}" >> $trace_file
echo "write_bytes=${io_stat1[5]}" >> $trace_file
}
nxf_trace_mac() {
local start_millis=$(nxf_date)
/bin/bash -euo pipefail /data/dermatogenomics4/libingjie/m6a/work/ac/16506e78617d85361373a198bdcfe0/.command.sh
local end_millis=$(nxf_date)
local wall_time=$((end_millis-start_millis))
local ucpu=''
local io_stat1=('' '' '' '' '' '')
nxf_write_trace
}
nxf_fd() {
local FD=11
while [ -e /proc/$$/fd/$FD ]; do FD=$((FD+1)); done
echo $FD
}
nxf_trace_linux() {
local pid=$$
command -v ps &>/dev/null || { >&2 echo "Command 'ps' required by nextflow to collect task metrics cannot be found"; exit 1; }
local num_cpus=$(< /proc/cpuinfo grep '^processor' -c)
local tot_time0=$(grep '^cpu ' /proc/stat | awk '{sum=$2+$3+$4+$5+$6+$7+$8+$9; printf "%.0f",sum}')
local cpu_time0=$(2> /dev/null < /proc/$pid/stat awk '{printf "%.0f", ($16+$17)*10 }' || echo -n 'X')
local io_stat0=($(2> /dev/null < /proc/$pid/io sed 's/^.*:\s*//' | head -n 6 | tr '\n' ' ' || echo -n '0 0 0 0 0 0'))
local start_millis=$(nxf_date)
trap 'kill $mem_proc' ERR
/bin/bash -euo pipefail /data/dermatogenomics4/libingjie/m6a/work/ac/16506e78617d85361373a198bdcfe0/.command.sh &
local task=$!
mem_fd=$(nxf_fd)
eval "exec $mem_fd> >(nxf_mem_watch $task)"
local mem_proc=$!
wait $task
local end_millis=$(nxf_date)
local tot_time1=$(grep '^cpu ' /proc/stat | awk '{sum=$2+$3+$4+$5+$6+$7+$8+$9; printf "%.0f",sum}')
local cpu_time1=$(2> /dev/null < /proc/$pid/stat awk '{printf "%.0f", ($16+$17)*10 }' || echo -n 'X')
local ucpu=$(awk -v p1=$cpu_time1 -v p0=$cpu_time0 -v t1=$tot_time1 -v t0=$tot_time0 -v n=$num_cpus 'BEGIN { pct=(p1-p0)/(t1-t0)*100*n; printf("%.0f", pct>0 ? pct : 0) }' )
local io_stat1=($(2> /dev/null < /proc/$pid/io sed 's/^.*:\s*//' | head -n 6 | tr '\n' ' ' || echo -n '0 0 0 0 0 0'))
local i
for i in {0..5}; do
io_stat1[i]=$((io_stat1[i]-io_stat0[i]))
done
local wall_time=$((end_millis-start_millis))
[ $NXF_DEBUG = 1 ] && echo "+++ STATS %CPU=$ucpu TIME=$wall_time I/O=${io_stat1[*]}"
echo "nextflow.trace/v2" > $trace_file
echo "realtime=$wall_time" >> $trace_file
echo "%cpu=$ucpu" >> $trace_file
echo "rchar=${io_stat1[0]}" >> $trace_file
echo "wchar=${io_stat1[1]}" >> $trace_file
echo "syscr=${io_stat1[2]}" >> $trace_file
echo "syscw=${io_stat1[3]}" >> $trace_file
echo "read_bytes=${io_stat1[4]}" >> $trace_file
echo "write_bytes=${io_stat1[5]}" >> $trace_file
[ -e /proc/$mem_proc ] && eval "echo 'DONE' >&$mem_fd" || true
wait $mem_proc 2>/dev/null || true
while [ -e /proc/$mem_proc ]; do nxf_sleep 0.1; done
}
nxf_trace() {
local trace_file=.command.trace
touch $trace_file
if [[ $(uname) = Darwin ]]; then
nxf_trace_mac
else
nxf_trace_linux
fi
}
nxf_container_env() {
cat << EOF
export PATH="/data/dermatogenomics4/libingjie/m6a/MeRIPseqPipe/bin:\$PATH"
EOF
}
nxf_sleep() {
sleep $1 2>/dev/null || sleep 1;
}
nxf_date() {
local ts=$(date +%s%3N);
if [[ ${#ts} == 10 ]]; then echo ${ts}000
elif [[ $ts == *%3N ]]; then echo ${ts/\%3N/000}
elif [[ $ts == *3N ]]; then echo ${ts/3N/000}
elif [[ ${#ts} == 13 ]]; then echo $ts
else echo "Unexpected timestamp value: $ts"; exit 1
fi
}
nxf_env() {
echo '============= task environment ============='
env | sort | sed "s/\(.*\)AWS\(.*\)=\(.\{6\}\).*/\1AWS\2=\3xxxxxxxxxxxxx/"
echo '============= task output =================='
}
nxf_kill() {
declare -a children
while read P PP;do
children[$PP]+=" $P"
done < <(ps -e -o pid= -o ppid=)
kill_all() {
[[ $1 != $$ ]] && kill $1 2>/dev/null || true
for i in ${children[$1]:=}; do kill_all $i; done
}
kill_all $1
}
nxf_mktemp() {
local base=${1:-/tmp}
if [[ $(uname) = Darwin ]]; then mktemp -d $base/nxf.XXXXXXXXXX
else TMPDIR="$base" mktemp -d -t nxf.XXXXXXXXXX
fi
}
nxf_fs_copy() {
local source=$1
local target=$2
local basedir=$(dirname $1)
mkdir -p $target/$basedir
cp -fRL $source $target/$basedir
}
nxf_fs_move() {
local source=$1
local target=$2
local basedir=$(dirname $1)
mkdir -p $target/$basedir
mv -f $source $target/$basedir
}
nxf_fs_rsync() {
rsync -rRl $1 $2
}
on_exit() {
exit_status=${nxf_main_ret:=$?}
printf $exit_status > /data/dermatogenomics4/libingjie/m6a/work/ac/16506e78617d85361373a198bdcfe0/.exitcode
set +u
[[ "$tee1" ]] && kill $tee1 2>/dev/null
[[ "$tee2" ]] && kill $tee2 2>/dev/null
[[ "$ctmp" ]] && rm -rf $ctmp || true
docker rm $NXF_BOXID &>/dev/null || true
exit $exit_status
}
on_term() {
set +e
docker kill $NXF_BOXID
}
nxf_launch() {
docker run -i --cpus 2.0 --memory 6144m -e "NXF_DEBUG=${NXF_DEBUG:=0}" -v /data/dermatogenomics4/libingjie/m6a:/data/dermatogenomics4/libingjie/m6a -v "$PWD":"$PWD" -w "$PWD" --entrypoint /bin/bash -u $(id -u):$(id -g) --name $NXF_BOXID kingzhuky/meripseqpipe:dev -c "eval $(nxf_container_env); /bin/bash /data/dermatogenomics4/libingjie/m6a/work/ac/16506e78617d85361373a198bdcfe0/.command.run nxf_trace"
}
nxf_stage() {
true
# stage input files
rm -f TEST.gtf
ln -s /data/dermatogenomics4/libingjie/m6a/MeRIPseqPipe/test_datasets/reference/TEST.gtf TEST.gtf
}
nxf_unstage() {
true
[[ ${nxf_main_ret:=0} != 0 ]] && return
}
nxf_main() {
trap on_exit EXIT
trap on_term TERM INT USR2
trap '' USR1
[[ "${NXF_CHDIR:-}" ]] && cd "$NXF_CHDIR"
export NXF_BOXID="nxf-$(dd bs=18 count=1 if=/dev/urandom 2>/dev/null | base64 | tr +/ 0A)"
NXF_SCRATCH=''
[[ $NXF_DEBUG > 0 ]] && nxf_env
touch /data/dermatogenomics4/libingjie/m6a/work/ac/16506e78617d85361373a198bdcfe0/.command.begin
set +u
set -u
[[ $NXF_SCRATCH ]] && echo "nxf-scratch-dir $HOSTNAME:$NXF_SCRATCH" && cd $NXF_SCRATCH
nxf_stage
set +e
ctmp=$(set +u; nxf_mktemp /dev/shm 2>/dev/null || nxf_mktemp $TMPDIR)
local cout=$ctmp/.command.out; mkfifo $cout
local cerr=$ctmp/.command.err; mkfifo $cerr
tee .command.out < $cout &
tee1=$!
tee .command.err < $cerr >&2 &
tee2=$!
( nxf_launch ) >$cout 2>$cerr &
pid=$!
wait $pid || nxf_main_ret=$?
wait $tee1 $tee2
nxf_unstage
}
$NXF_ENTRY
Hi, 66zhuang! The .command.run file seems to have no problem. I think it might be a docker permission issue. But I'm sorry, I don't know what the problem is. Maybe, you can test another Nextflow pipeline to see if the same problem occurs. Or, you can enter the doker image and run the same code in .command.sh to test. In addition, we have updated DESeq.R file a while ago. You can clone the latest repository for using. Thank you very much for the useful feedback. If you solve the problem, please tell us! Thanks again. (We have tested this pipeline using Nextflow 20.10.0, docker 20.10.8, and it can work.)
I solved this problem. It looks like my old version docker that don't support my disk format. After move them to other disk, the error disappear. However, there are different error.
rror executing process > 'Fastp (control_1.input)'
Caused by:
Process `Fastp (control_1.input)` terminated with an error exit status (255)
Command executed:
if [ false == "false" ]; then
fastp -i control_1.input.fastq.gz -o control_1.input_aligners.fastq.gz -j control_1.input_fastp.json -h control_1.input_fastp.html -w 2
else
mv control_1.input.fastq.gz control_1.input_aligners.fastq.gz
fi
Command exit status:
255
Command output:
(empty)
Command error:
Error to read gzip file
Detecting adapter sequence for read1...
Error to read gzip file
No adapter detected for read1
ERROR: file 'control_1.input.fastq.gz' doesn't exist, quit now
Work dir:
/home/xxx/work/7d/eaa146b6a0e395ee5fc50796cfd5c5
and I found that
control_1.input.fastq.gz -> /home/xxx/test_datasets/test_data/single_data/control_1.input.fastq.gz
it is strange that why the data is link to the non-existed directory??
After I move the test_datasets to my home directory, another error happens:
Error executing process > 'Macs2 (treated_2)'
Caused by:
Process `Macs2 (treated_2)` terminated with an error exit status (2)
Command executed:
genome_size=$(faCount TEST.fa | tail -1 | awk '{print $2-$7}')
if [ 1 -gt 1 ]; then samtools merge -f macs2_treated_2_ip.bam treated_2.ip_treated.bam; fi
if [ 1 -gt 1 ]; then samtools merge -f macs2_treated_2_input.bam treated_2.input_treated.bam; fi
macs2 callpeak -t *treated_2*ip*.bam -c *treated_2*input*.bam -g $genome_size -n macs2_treated_2 -q 0.01 --keep-dup 5 -f BAM --nomodel
awk -v OFS="\t" '{print $1,$2,$3,$1":"$2"-"$3,10^-$8}' macs2_treated_2_peaks.narrowPeak > macs2_treated_2_normalized.bed
mv macs2_treated_2_summits.bed macs2_treated_2.summits
Command exit status:
2
Command output:
(empty)
Command error:
INFO @ Wed, 02 Mar 2022 14:42:08:
# Command line: callpeak -t treated_2.ip_treated.bam -c treated_2.input_treated.bam -g 14352809 -n macs2_treated_2 -q 0.01 --keep-dup 5 -f BAM --nomodel
# ARGUMENTS LIST:
# name = macs2_treated_2
# format = BAM
# ChIP-seq file = ['treated_2.ip_treated.bam']
# control file = ['treated_2.input_treated.bam']
# effective genome size = 1.44e+07
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 1.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 1000 bps and 10000 bps
# Broad region calling is off
# Paired-End mode is off
INFO @ Wed, 02 Mar 2022 14:42:08: #1 read tag files...
INFO @ Wed, 02 Mar 2022 14:42:08: #1 read treatment tags...
Exception struct.error: 'unpack requires a string argument of length 4' in 'MACS2.IO.Parser.BAMParser.tsize' ignored
INFO @ Wed, 02 Mar 2022 14:42:08: #1.2 read input tags...
INFO @ Wed, 02 Mar 2022 14:42:08: #1 tag size is determined as 0 bps
CRITICAL @ Wed, 02 Mar 2022 14:42:08: No common chromosome names can be found from treatment and control! Check your input files! MACS will quit...
CRITICAL @ Wed, 02 Mar 2022 14:42:08: Chromosome names in treatment:
CRITICAL @ Wed, 02 Mar 2022 14:42:08: Chromosome names in control:
awk: cannot open macs2_treated_2_peaks.narrowPeak (No such file or directory)
Hi! You can run this pipe in the /path/to/MeRIPseqPipe. The major issue is the file path in the designfile.tsv.
Sample_ID input_R1 input_R2 ip_R1 ip_R2 Group_ID control_1 ./test_datasets/test_data/paired_data/control_1.input_1.fastq.gz ./test_datasets/test_data/paired_data/control_1.input_2.fastq.gz ./test_datasets/test_data/paired_data/control_1.ip_1.fastq.gz ./test_datasets/test_data/paired_data/control_1.ip_2.fastq.gz control control_2 ./test_datasets/test_data/paired_data/control_2.input_1.fastq.gz ./test_datasets/test_data/paired_data/control_2.input_2.fastq.gz ./test_datasets/test_data/paired_data/control_2.ip_1.fastq.gz ./test_datasets/test_data/paired_data/control_2.ip_2.fastq.gz control
Hi, after I re-run the pipe in the /path/to/MeRIPseqPipe, another error happens.
Caused by:
Process `Macs2 (treated_1)` terminated with an error exit status (2)
executor > local (59)
[32/afdb32] process > CheckDesignCompare [100%] 1 of 1 ✔
[0d/84ba91] process > makeBED12 (gtf2bed12) [100%] 1 of 1 ✔
[bd/d1afa2] process > makechromesize (gtf2bed12) [100%] 1 of 1 ✔
[- ] process > MakeTophat2Index -
[- ] process > MakeHisat2Index -
[- ] process > MakeBWAIndex -
[0c/3f5e7a] process > MakeStarIndex (star_index) [100%] 1 of 1 ✔
[- ] process > MakerRNAindex -
[54/daec9b] process > Fastp (control_2.ip) [100%] 8 of 8 ✔
[8e/5ea287] process > Fastqc (control_2.ip) [100%] 8 of 8 ✔
[- ] process > Tophat2Align -
[- ] process > Hisat2Align -
[- ] process > BWAAlign -
[fa/5e4792] process > StarAlign (control_1.ip) [100%] 8 of 8 ✔
[be/2c58b3] process > SortRename (control_1.ip_control) [100%] 8 of 8 ✔
[47/c1a0ff] process > RSeQC (control_1.ip_control) [100%] 8 of 8 ✔
[- ] process > CreateBedgraph -
[- ] process > multiqc -
[ee/5fda1e] process > FeatureCount [100%] 1 of 1 ✔
[- ] process > DESeq2 -
[- ] process > EdgeR -
[00/02a8a6] process > Metpeak (treated_1) [100%] 4 of 4, failed: 4 ✘
[04/ccf77f] process > Macs2 (treated_2) [100%] 4 of 4, failed: 4 ✘
[7b/0fe58d] process > MATKpeakCalling (control_2) [100%] 4 of 4, failed: 4 ✘
[c3/cce342] process > MeyerPrepration (onecore_peak) [100%] 1 of 1 ✔
[- ] process > Meyer [ 0%] 0 of 4
[- ] process > PeakMerge -
[- ] process > BedAnnotated -
[- ] process > MotifSearching -
[- ] process > PeaksMotifReport -
[- ] process > PeaksQuantification -
[- ] process > diffm6APeak -
[- ] process > SingleNucleotidePrediction -
[- ] process > DiffReport -
[- ] process > CreateIGVjs -
[8b/85c18d] process > get_software_versions [100%] 1 of 1 ✔
Error executing process > 'Macs2 (treated_1)'
Caused by:
Process `Macs2 (treated_1)` terminated with an error exit status (2)
Command executed:
genome_size=$(faCount TEST.fa | tail -1 | awk '{print $2-$7}')
if [ 1 -gt 1 ]; then samtools merge -f macs2_treated_1_ip.bam treated_1.ip_treated.bam; fi
if [ 1 -gt 1 ]; then samtools merge -f macs2_treated_1_input.bam treated_1.input_treated.bam; fi
macs2 callpeak -t *treated_1*ip*.bam -c *treated_1*input*.bam -g $genome_size -n macs2_treated_1 -q 0.01 --keep-dup 5 -f BAM --nomodel
awk -v OFS="\t" '{print $1,$2,$3,$1":"$2"-"$3,10^-$8}' macs2_treated_1_peaks.narrowPeak > macs2_treated_1_normalized.bed
mv macs2_treated_1_summits.bed macs2_treated_1.summits
Command exit status:
2
Command output:
(empty)
Command error:
INFO @ Thu, 03 Mar 2022 02:05:48:
# Command line: callpeak -t treated_1.ip_treated.bam -c treated_1.input_treated.bam -g 14352809 -n macs2_treated_1 -q 0.01 --keep-dup 5 -f BAM --nomodel
# ARGUMENTS LIST:
# name = macs2_treated_1
# format = BAM
# ChIP-seq file = ['treated_1.ip_treated.bam']
# control file = ['treated_1.input_treated.bam']
# effective genome size = 1.44e+07
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 1.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 1000 bps and 10000 bps
# Broad region calling is off
# Paired-End mode is off
INFO @ Thu, 03 Mar 2022 02:05:48: #1 read tag files...
INFO @ Thu, 03 Mar 2022 02:05:48: #1 read treatment tags...
Exception struct.error: 'unpack requires a string argument of length 4' in 'MACS2.IO.Parser.BAMParser.tsize' ignored
INFO @ Thu, 03 Mar 2022 02:05:48: #1.2 read input tags...
INFO @ Thu, 03 Mar 2022 02:05:48: #1 tag size is determined as 0 bps
CRITICAL @ Thu, 03 Mar 2022 02:05:48: No common chromosome names can be found from treatment and control! Check your input files! MACS will quit...
CRITICAL @ Thu, 03 Mar 2022 02:05:48: Chromosome names in treatment:
CRITICAL @ Thu, 03 Mar 2022 02:05:48: Chromosome names in control:
awk: cannot open macs2_treated_1_peaks.narrowPeak (No such file or directory)
Work dir:
/home/libingjie/MeRIPseqPipe/work/9f/1abca8eaa25f9471c753a4c4c7b818
Tip: view the complete command output by changing to the process work dir and entering the command `cat .command.out`
I find the MACS2 input bam file is empty, which was due to the failed StarAlign process. Here is the data in control_1.ipLog.final.out.
Started job on | Mar 03 02:05:15
Started mapping on | Mar 03 02:05:41
Finished on | Mar 03 02:05:42
Mapping speed, Million of reads per hour | 0.00
Number of input reads | 0
Average input read length | 0
UNIQUE READS:
Uniquely mapped reads number | 0
Uniquely mapped reads % | 0.00%
Average mapped length | 0.00
Number of splices: Total | 0
Number of splices: Annotated (sjdb) | 0
Number of splices: GT/AG | 0
Number of splices: GC/AG | 0
Number of splices: AT/AC | 0
Number of splices: Non-canonical | 0
Mismatch rate per base, % | -nan%
Deletion rate per base | 0.00%
Deletion average length | 0.00
Insertion rate per base | 0.00%
Insertion average length | 0.00
MULTI-MAPPING READS:
Number of reads mapped to multiple loci | 0
% of reads mapped to multiple loci | 0.00%
Number of reads mapped to too many loci | 0
% of reads mapped to too many loci | 0.00%
UNMAPPED READS:
% of reads unmapped: too many mismatches | 0.00%
% of reads unmapped: too short | 0.00%
% of reads unmapped: other | 0.00%
CHIMERIC READS:
Number of chimeric reads | 0
% of chimeric reads | 0.00%
But the input data in the same folder is not empty.
less control_1.ip_aligners.fastq.gz | head
@SRR1182619.276/2
GGTATTATCATTTTTCCAAAAGTTACAGCA
+
BBBFFFFFFFFFFIIIIIIIIIIIIIIIII
@SRR1182619.653/2
ATCTTTGTTGTTTTAAAACACACAGTGAAG
+
BBBFFFFFFFFFFIIIIIIIIIIIIFIIII
@SRR1182619.1319/2
TCATCAACCTGGATGTTACGGAAGTTTTTC
Is it the STAR mapping issue?
Hi! Can other aligners work? You can change this parameter in nextflow.config: aligners = "star" // "star" OR "bwa" OR "tophat2" OR "hisat2" OR "none"
I re-test,but can not get this error.
$ nextflow run /data1/baoxq/pipe/MeRIPseqPipe-1.0 -profile test,docker
N E X T F L O W ~ version 20.10.0
Launching /data1/baoxq/pipe/MeRIPseqPipe-1.0/main.nf
[small_meucci] - revision: 992c8903be
WARN: There's no process matching config selector: fastp -- Did you mean: Fastp?
WARN: There's no process matching config selector: sort
▄▄▄▄▄▄▄▄▄▄▄ ▄ ▄ ▄▄▄▄▄▄▄▄▄▄▄ ▄ ▄ ▄▄▄▄▄▄▄▄▄▄▄ ▄▄▄▄▄▄▄▄▄▄▄
▐░░░░░░░░░░░▌▐░▌ ▐░▌▐░░░░░░░░░░░▌▐░▌ ▐░▌▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌
▐░█▀▀▀▀▀▀▀▀▀ ▐░▌ ▐░▌▐░█▀▀▀▀▀▀▀▀▀ ▐░▌ ▐░▌▐░█▀▀▀▀▀▀▀▀▀ ▐░█▀▀▀▀▀▀▀▀▀
▐░▌ ▐░▌ ▐░▌▐░▌ ▐░▌ ▐░▌▐░▌ ▐░▌
▐░█▄▄▄▄▄▄▄▄▄ ▐░█▄▄▄▄▄▄▄█░▌▐░█▄▄▄▄▄▄▄▄▄ ▐░▌ ▐░▌▐░▌ ▐░▌
▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌▐░▌ ▐░▌▐░▌ ▐░▌
▀▀▀▀▀▀▀▀▀█░▌ ▀▀▀▀█░█▀▀▀▀ ▀▀▀▀▀▀▀▀▀█░▌▐░▌ ▐░▌▐░▌ ▐░▌
▐░▌ ▐░▌ ▐░▌▐░▌ ▐░▌▐░▌ ▐░▌
▄▄▄▄▄▄▄▄▄█░▌ ▐░▌ ▄▄▄▄▄▄▄▄▄█░▌▐░█▄▄▄▄▄▄▄█░▌▐░█▄▄▄▄▄▄▄▄▄ ▐░█▄▄▄▄▄▄▄▄▄
▐░░░░░░░░░░░▌ ▐░▌ ▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌▐░░░░░░░░░░░▌
▀▀▀▀▀▀▀▀▀▀▀ ▀ ▀▀▀▀▀▀▀▀▀▀▀ ▀▀▀▀▀▀▀▀▀▀▀ ▀▀▀▀▀▀▀▀▀▀▀ ▀▀▀▀▀▀▀▀▀▀▀
null
============You are running MeRIPseqPipe with the following parameters===============
Checking parameters ...
===================================Pipeline summary=============================
Max Resources : 6 GB memory, 2 cpus, 2d time per job
Container : docker - kingzhuky/meripseqpipe:dev
Output dir : /data1/baoxq/pipe/MeRIPseqPipe-1.0/results
Launch dir : /data1/baoxq/pipe/MeRIPseqPipe-1.0
Working dir : /data1/baoxq/pipe/MeRIPseqPipe-1.0/work
Script dir : /data1/baoxq/pipe/MeRIPseqPipe-1.0
User : baoxq
Config Profile : test,docker
Config Description : Minimal test dataset to check pipeline function
=====================================Reads types================================
SingleEnd : Single-End
Stranded : no
gzip : true
====================================Mode selected==============================
aligners : star
peakCalling_mode : independence
peakMerged_mode : rank
expression_analysis_mode : DESeq2
methylation_analysis_mode : QNB
==================================Input files selected==========================
Reads Path : false
fasta file : /data1/baoxq/pipe/MeRIPseqPipe-1.0/test_datasets/reference/TEST.fa
Gtf file : /data1/baoxq/pipe/MeRIPseqPipe-1.0/test_datasets/reference/TEST.gtf
Design file : /data1/baoxq/pipe/MeRIPseqPipe-1.0/test_datasets/inputfiles/designfile_single.tsv
Compare file : /data1/baoxq/pipe/MeRIPseqPipe-1.0/test_datasets/inputfiles/comparefile.txt
==================================Skip model selected==========================
Skip samtools sort : false
Skip expression analysis : false
Skip peakCalling : false
Skip diffpeakCalling : false
Skip annotation : false
Skip qc : false
executor > local (45)
executor > local (64)
executor > local (65)
executor > local (66)
[82/0e7b9f] process > CheckDesignCompare [100%] 1 of 1 ✔
[d6/c6d92f] process > makeBED12 (gtf2bed12) [100%] 1 of 1 ✔
[8a/aad10b] process > makechromesize (gtf2bed12) [100%] 1 of 1 ✔
executor > local (89)
executor > local (90)
executor > local (93)
[82/0e7b9f] process > CheckDesignCompare [100%] 1 of 1 ✔
[d6/c6d92f] process > makeBED12 (gtf2bed12) [100%] 1 of 1 ✔
[8a/aad10b] process > makechromesize (gtf2bed12) [100%] 1 of 1 ✔
[- ] process > MakeTophat2Index -
[- ] process > MakeHisat2Index -
[- ] process > MakeBWAIndex -
[7f/478a23] process > MakeStarIndex (star_index) [100%] 1 of 1 ✔
[- ] process > MakerRNAindex -
[c8/85230c] process > Fastp (control_1.ip) [100%] 8 of 8 ✔
[35/5588fb] process > Fastqc (control_1.ip) [100%] 8 of 8 ✔
[- ] process > Tophat2Align -
[- ] process > Hisat2Align -
[- ] process > BWAAlign -
[80/c6a00a] process > StarAlign (treated_1.ip) [100%] 8 of 8 ✔
[65/169de6] process > SortRename (treated_1.ip_treated) [100%] 8 of 8 ✔
[dc/2989cc] process > RSeQC (treated_1.ip_treated) [100%] 8 of 8 ✔
[- ] process > CreateBedgraph -
[5f/4d2649] process > multiqc [100%] 1 of 1 ✔
[ac/3ec73a] process > FeatureCount [100%] 1 of 1 ✔
[4a/d6b1f0] process > DESeq2 (treated_vs_control) [100%] 1 of 1 ✔
[- ] process > EdgeR -
[b2/cfca67] process > Metpeak (treated_2) [100%] 4 of 4 ✔
[c5/bed106] process > Macs2 (treated_1) [100%] 4 of 4 ✔
[ad/1e06ed] process > MATKpeakCalling (control_1) [100%] 4 of 4 ✔
[54/9852f5] process > MeyerPrepration (onecore_peak) [100%] 1 of 1 ✔
[83/84d1d1] process > Meyer (treated_1) [100%] 4 of 4 ✔
[ff/0ffc82] process > PeakMerge [100%] 1 of 1 ✔
[5c/6ae672] process > BedAnnotated (rank_merged_group_control) [100%] 19 of 19 ✔
[d1/65ba5b] process > MotifSearching (rank_merged_allpeaks) [100%] 3 of 3 ✔
[95/18bea4] process > PeaksMotifReport [100%] 1 of 1 ✔
[ec/80ca4c] process > PeaksQuantification [100%] 1 of 1 ✔
[5c/8f2cc4] process > diffm6APeak (treated_vs_control) [100%] 1 of 1 ✔
[2a/328023] process > SingleNucleotidePrediction [100%] 1 of 1 ✔
[8a/ff7103] process > DiffReport [100%] 1 of 1 ✔
[- ] process > CreateIGVjs -
[bf/289c57] process > get_software_versions [100%] 1 of 1 ✔
[0;35m[MeRIPseqPpipe] Pipeline completed successfully
WARN: [MeRIPseqPpipe] Found multiple reports from process 'multiqc', will use only one
WARN: To render the execution DAG in the required format it is required to install Graphviz -- See http://www.graphviz.org for more info.
Completed at: 03-Mar-2022 11:31:16
Duration : 4m 51s
CPU hours : 0.6
Succeeded : 93
Hi cnaceromics, other aligners work well! It looks like the STAR doesn't support this disk format as STAR works well in another disk. So I ran mapping using STAR on another disk and got the bam files. Then run the nextflow pipe using bam files as the input file in this disk. I'm running my own data and so far everything works fine. Thanks for your quick reply!!
I'm seeing this error: Command error: touch: cannot touch '.command.trace': Permission denied during running the minimal test dataset. how to fix it?