search

cbg-ethz / shorah

Repo for the software suite ShoRAH (Short Reads Assembly into Haplotypes)
GNU General Public License v3.0
39 stars 14 forks source link

what are the "-----" #56

Closed jeffchen2000 closed 5 years ago

jeffchen2000 commented 5 years ago

in global haplotype sequence as below, I see "----", are they sequence gaps/deletions? or unclear bases like 'N'?

GAATACCCGGCAGATTACTTCAGAAAATCAAAGGAGATTCCTCTTTACATCAATACTA-- -------TGTCAGATCTAAGAGGATATGTCTACCAAGGCCTCAAATCCGGAAATGTATCA ATCATACATGTCAACAGCTACTTGTATGGAGCATTAAAGGACATCCGGGGTAAGTTGGAT

DrYak commented 5 years ago

I see "----", are they sequence gaps/deletions?

yes, exactly. at this point the reconstructed haplotype has gaps in regards to the reference.