Closed ArtPoon closed 9 years ago
It looks like this is a legitimate stop codon leading to a null allelic form of HLA-B.
The nucleotide sequence is an exact match for Genbank record LN624507.1 at exon 2, with the exception of a deletion error in codon 44.
For example, reverse-complement of CACACAGACTGACCGAGAGAG
, which contains this stop codon, appears 4028 times in a raw FASTQ file and mapped to HLA-B.
Figure out if this is a frame shift error in alignment. Run 130311, see sample 57974A-5 and others.