search

cfe-lab / MiCall

Pipeline for processing FASTQ data from an Illumina MiSeq to genotype human RNA viruses like HIV and hepatitis C
https://cfe-lab.github.io/MiCall
GNU Affero General Public License v3.0
14 stars 9 forks source link

Gap in HLA-B associated with stop codon at exon 2, codon 73 #187

Closed ArtPoon closed 9 years ago

ArtPoon commented 9 years ago

Figure out if this is a frame shift error in alignment. Run 130311, see sample 57974A-5 and others.

ArtPoon commented 9 years ago

It looks like this is a legitimate stop codon leading to a null allelic form of HLA-B. The nucleotide sequence is an exact match for Genbank record LN624507.1 at exon 2, with the exception of a deletion error in codon 44. For example, reverse-complement of CACACAGACTGACCGAGAGAG, which contains this stop codon, appears 4028 times in a raw FASTQ file and mapped to HLA-B.