search

chadlaing / Panseq

Pan-genomic sequence analysis
http://lfz.corefacility.ca/panseq
GNU General Public License v3.0
43 stars 14 forks source link

An error was encountered during analyses #11

Closed liuxiong714 closed 7 years ago

liuxiong714 commented 7 years ago

Hi!

I was using Panseq to analysis a group of genomes, but I have a problem as below:

An error was encountered during analyses. If you uploaded your own data, please ensure it is fasta formatted, and if more than one genome is present in a file, please ensure that the fasta headers follow the format in the FAQ. Please try your analyses again, and if you continue to experience problems, send an email to chad.laing at the canada.ca domain. Thank you for using Panseq.

I have several singular files like this:

lcl|s201|seqone agcaaccaatctaatcacaagtaactgtttttcaacaagtttctatctgcatcaccgccg atggatgtgcattatagaccatctcattccctttgcaaggggtatttatccctttttcac ttgagtgccgtttttttctactattttgcgaaaa...............

lcl|s202|seqone agcaaccaatctaatcacaagtaactgtttttcaacaagtttctatctgcatcaccgccg atggatgtgcattatagaccatctcattccctttgcaaggggtatttatccctttttcac ttgagtgccgtttttttctactattttgcgaaaa.......................

lcl|s203|seqone agcaaccaatctaatcacaagtaactgtttttcaacaagtttctatctgcatcaccgccg atggatgtgcattatagaccatctcattccctttgcaaggggtatttatccctttttcac ttgagtgccgtttttttctactattttgcgaaaaaagtgata...................

Is there any wrong with my file format? I can't find it

thanks very much!

chadlaing commented 7 years ago

Hi,

Provided that the headers are really >lcl|s201|seqone then there shouldn't be an issue with the format. Let me know if you are still experiencing problems, and I will run a test on the server.

Thanks, Chad