Problem using -f list option

[aureliendejode]

Hello,

I am trying to use caster site using a list of fasta files. But I got an error and cannot figure out why even though I managed to run the same command before.

Is there anything in particular I should check for these options ?

Here is my command:

caster-site -R -t 6 -i list_fasta.txt -f list -o caster_site_output 2>castersite.log

I have several fasta files in a folder:

uce-111199.fasta uce-990291466.fasta uce-11379.fasta uce-9901043.fasta uce-114899.fasta uce-990291657.fasta uce-115890.fasta uce-116220.fasta uce-9901553.fasta uce-990149.fasta

My fasta files look like this:

A_californica_mex40a acttacggttctcatgaataacgtcggaagaggattgacttccatcagctgctgcagcac gatggccagtacttcttgtgtgtagatggtcttttcatcgaagcagtatctgatggctgg ata A_flosculifera_from_Bocas_pan16_48 acttacggttctcatgaataacgtcggaagaggattgacttccatcagctgctgcagcac gatggccagtacttcttgtgtgtagatggtcttttcatcgaagcagtatctgatggctgg ata A_flosculifera_from_mexico_rg149b acttacggttctcatgaataacgtcggaagaggattgacttccatcagctgctgcagcac gatggccagtacttcttgtgtgtagatggtcttttcatcgaagcagtatctgatggctgg ata Actinia_equina_ACT_18 acttactgttctcataaataatgttggtagaggattgacttccatcaactgctggagcac gatggccagtacttcttgtgtgtagatggttttttcatcgaagcagaatctaatggctgt aca Actinia_equina_ACT_21 acttacggttctcatgaataacgttggtagaggattgacttccatcaactgctgcagcac gatagccagcacttcttgtgtgtagatggtcttttcatcgaaacagtatctgatagctgc aca

[chaoszhang]

Can you send me one of your input file? It seems like you didn't have ">" symbol in your fasta file.

获取Outlook for Androidhttps://aka.ms/AAb9ysg

---

From: aureliendejode @.> Sent: Friday, January 5, 2024 12:05:25 PM To: chaoszhang/ASTER @.> Cc: Subscribed @.***> Subject: [chaoszhang/ASTER] Problem using -f list option (Issue #18)

Hello,

I am trying to use caster site using a list of fasta files. But I got an error and cannot figure out why even though I managed to run the same command before.

Is there anything in particular I should check for these options ?

Here is my command:

caster-site -R -t 6 -i list_fasta.txt -f list -o caster_site_output 2>castersite.log

I have several fasta files in a folder:

uce-111199.fasta uce-990291466.fasta uce-11379.fasta uce-9901043.fasta uce-114899.fasta uce-990291657.fasta uce-115890.fasta uce-116220.fasta uce-9901553.fasta uce-990149.fasta

My fasta files look like this:

A_californica_mex40a acttacggttctcatgaataacgtcggaagaggattgacttccatcagctgctgcagcac gatggccagtacttcttgtgtgtagatggtcttttcatcgaagcagtatctgatggctgg ata A_flosculifera_from_Bocas_pan16_48 acttacggttctcatgaataacgtcggaagaggattgacttccatcagctgctgcagcac gatggccagtacttcttgtgtgtagatggtcttttcatcgaagcagtatctgatggctgg ata A_flosculifera_from_mexico_rg149b acttacggttctcatgaataacgtcggaagaggattgacttccatcagctgctgcagcac gatggccagtacttcttgtgtgtagatggtcttttcatcgaagcagtatctgatggctgg ata Actinia_equina_ACT_18 acttactgttctcataaataatgttggtagaggattgacttccatcaactgctggagcac gatggccagtacttcttgtgtgtagatggttttttcatcgaagcagaatctaatggctgt aca Actinia_equina_ACT_21 acttacggttctcatgaataacgttggtagaggattgacttccatcaactgctgcagcac gatagccagcacttcttgtgtgtagatggtcttttcatcgaaacagtatctgatagctgc aca

― Reply to this email directly, view it on GitHubhttps://github.com/chaoszhang/ASTER/issues/18, or unsubscribehttps://github.com/notifications/unsubscribe-auth/AEOCTID2TTAJVRWIYELYCMDYNBMILAVCNFSM6AAAAABBO4YS2SVHI2DSMVQWIX3LMV43ASLTON2WKOZSGA3DOOJWG4ZTKNY. You are receiving this because you are subscribed to this thread.Message ID: @.***>

[chaoszhang]

I see. You may need to run caster-site -R -t 6 -i list_fasta.txt -f list -o caster_site_output 2>caster_site_.log in your fasta folder. Or you need to add relative/absolute path to your fasta files: PATH/uce-111199.fasta PATH/uce-990291466.fasta PATH/uce-11379.fasta ...