chr1swallace
commented
1 year ago Hi,
I'm afraid just having the top hits is not going to be enough. Please see the vignette http://chr1swallace.github.io/coloc/articles/a02_data.html [https://chr1swallace.github.io/coloc/logo.png]http://chr1swallace.github.io/coloc/articles/a02_data.html Coloc: data structures • coloc - GitHub Pageshttp://chr1swallace.github.io/coloc/articles/a02_data.html Data structures. The enumeration approaches to coloc coloc.abf and coloc.susie require the same data format. To be flexible, coloc.abf allows a wider variety of inputs, which can sometimes be confusing. This document aims to set out what ideal and acceptable data structures are, as well as covering some points on how you should select the SNPs for study. chr1swallace.github.io
MAF can be either minor allele frequency or effect allele frequency - it is used as f*(1-f) but should be the MAF as close as possible to the samples in your study. LD does need to be r and not rsquared.
From: HKJ396 @.> Sent: 19 October 2022 10:22 To: chr1swallace/coloc @.> Cc: Subscribed @.***> Subject: [chr1swallace/coloc] MAF score from GWAS results using COLOC.susie as well as LD matrix question (Issue #101)
Hello,
Thank you so much for developing this package. I have my GWAS summary data filtered so it's just the top hits, GTEx eqtl data for the relevant tissue, and an LD matrix. However, I have a couple of questions regarding the coloc.susie function.
First of all, when I supply MAF scores for the GWAS summary results, is this the minor allele frequency or just the frequency of the associated allele which might not necessarily be the minor allele? For example, when I look at my plink allele freq output I might be given a frequency that is above 0.5 for one allele and for another allele I might be given a value below 0.5? For example,
Here’s the first lines of the file:
CHROM ID REF ALT ALT_FREQS OBS_CT
1 rs376342519:10616:CCGCCGTTGCAAAGGCGCGCCG:C CCGCCGTTGCAAAGGCGCGCCG C 0.995708 3862 1 1:54712:T:TTTTC T TTTTC 0.595903 3862 1 rs368808541:603010:C:A C A 0.00194132 3862
The frequency is given for C – 0.995… Whereas on db SNP the MAF is ~ 0.1 for CCGCCGTTGCAAAGGCGCGCCG For the third line rs368808541 – the MAF matches what’s on dbSNP. Therefore, I'm not sure if this is the values I should use in the coloc function? Or should I do 1-(any value above 0.5) to find the minor allele?
I have also calculated an LD matrix for my top SNPs - using the PLINK --r2 function so that only SNPs within 1Mb of my top SNPs and r2 above 0.6 is present. Is this okay? I notice the manual states to use --r function rather than r2 if the datasets have different LD however I will only match up the SNPs that are common in both so I assuming they will have the same LD?
Thank you in advance.
— Reply to this email directly, view it on GitHubhttps://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fchr1swallace%2Fcoloc%2Fissues%2F101&data=05%7C01%7Ccew54%40universityofcambridgecloud.onmicrosoft.com%7C0392c7ba3acc437cf90d08dab1b37fd4%7C49a50445bdfa4b79ade3547b4f3986e9%7C0%7C0%7C638017681740704283%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=JzZgJamdmiY18Dqwcjgcw%2B4OclexEcV6zA8owNcg3EE%3D&reserved=0, or unsubscribehttps://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fnotifications%2Funsubscribe-auth%2FAAQWR2D5IZ5LNZKWQBIKCKLWD64WVANCNFSM6AAAAAARI5DROU&data=05%7C01%7Ccew54%40universityofcambridgecloud.onmicrosoft.com%7C0392c7ba3acc437cf90d08dab1b37fd4%7C49a50445bdfa4b79ade3547b4f3986e9%7C0%7C0%7C638017681740704283%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=EaNPu9j60EU30rC2CIBurzTvphDP2zhr1m7hHVkidVo%3D&reserved=0. You are receiving this because you are subscribed to this thread.Message ID: @.***>
HKJ396
Hello,
Thank you so much for developing this package. I have my GWAS summary data filtered so it's just the top hits, GTEx eqtl data for the relevant tissue, and an LD matrix. However, I have a couple of questions regarding the coloc.susie function.
First of all, when I supply MAF scores for the GWAS summary results, is this the minor allele frequency or just the frequency of the associated allele which might not necessarily be the minor allele? For example, when I look at my plink allele freq output I might be given a frequency that is above 0.5 for one allele and for another allele I might be given a value below 0.5? For example,
Here’s the first lines of the file:
CHROM ID REF ALT ALT_FREQS OBS_CT
1 rs376342519:10616:CCGCCGTTGCAAAGGCGCGCCG:C CCGCCGTTGCAAAGGCGCGCCG C 0.995708 3862 1 1:54712:T:TTTTC T TTTTC 0.595903 3862 1 rs368808541:603010:C:A C A 0.00194132 3862
The frequency is given for C – 0.995… Whereas on db SNP the MAF is ~ 0.1 for CCGCCGTTGCAAAGGCGCGCCG For the third line rs368808541 – the MAF matches what’s on dbSNP. Therefore, I'm not sure if this is the values I should use in the coloc function? Or should I do 1-(any value above 0.5) to find the minor allele?
I have also calculated an LD matrix for my top SNPs - using the PLINK --r2 function so that only SNPs within 1Mb of my top SNPs and r2 above 0.6 is present. Is this okay? I notice the manual states to use --r function rather than r2 if the datasets have different LD however I will only match up the SNPs that are common in both so I assuming they will have the same LD?
Thank you in advance.