search

constellation-app / constellation

A graph-focused data visualisation and interactive analysis application.
https://constellation-app.com
Apache License 2.0
386 stars 59 forks source link

Add a new SARS-CoV-2 visualisation data sample set #469

Closed CrucisGamma closed 3 years ago

CrucisGamma commented 4 years ago

Not entirely sure if it's possible, but I think mapping out the SARS-CoV-2 DNA sequencing would be something to be able to do and may open up Constellation to different fields that may not have looked at it previously.

I've downloaded the SARS-CoV-2 genome (from here I believe https://genexa.ch/sars2-bioinformatics-resources/) but it's only the ACGT type data for the nucleotides(?)

>NC_045512 |Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1| complete genome
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT
GTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACT
CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATC
TTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT
CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAAC

etc

I'm not entirely sure where the spatial data for constellation is as in how the spatial information for the parts of the dna that fold back on itself and forms the 'spike' for the ACE-2 receptor but being able to get that information from somewhere would allow a pretty cool default data set to have and to be able to display in 3d (something that looks a bit like this: https://cdn.geekwire.com/wp-content/uploads/2020/02/200219-cov19-1-630x344.jpg)

CrucisGamma commented 4 years ago

200219-cov19-1-630x344

Guilty-Spark-343 commented 4 years ago

Yeah I love this idea! Were you thinking of having a a few samples to show what Constellation can do or a plugin to pull these proteins and map them? I'm not sure how you'd go about mapping the above biological assembly but we can definitely map the the atom structure. I had a go today and it looks like this...

Guilty-Spark-343 commented 4 years ago

COVID19_spike_snap

Guilty-Spark-343 commented 4 years ago

Constellation_covid19_spike_glycoprotein.zip I've attached the star graph and a 10sec video panning around the protein

CrucisGamma commented 4 years ago

@Guilty-Spark-343 Where did you get the data source? I wasn't really sure what to look for

Guilty-Spark-343 commented 4 years ago

Yeah it worked really well, super happy how it turned out! I pulled the structure from https://www.rcsb.org/structure/6VXX as a PDB file (Protein Data Bank) which is the atom structure then constellated it in a simple notebook with biopython. We can't generally go from the nucleotide sequence to structure but RCSB has thousands of structures in that PDB format.

arcturus2 commented 4 years ago

Wow @Guilty-Spark-343 that is super amazing! Well done!

github-actions[bot] commented 3 years ago

This issue is stale because it has been open for 6 months with no activity. Consider reviewing and taking an action on this issue.

aldebaran30701 commented 3 years ago

Closing this but adding it to the ticket #850 as it would be a worthy addition to the website to advertise what Constellation is capable of.