search

ctSkennerton / crass

The CRISPR assembler
http://ctskennerton.github.io/crass
GNU General Public License v3.0
35 stars 11 forks source link

v0.3.7 error #87

Closed snayfach closed 7 years ago

snayfach commented 7 years ago

I ran crass version 0.3.7 with this sequence:

>seq1
GAACGCCACAGCTAATGCAACGGAAACAACCATGAATCAGGCAGAAAGCACTGTTAATACTGCTGCGAACGCCACAGCTAATGCAACGGAAACAACCATGAATCAGGCAGGAAATGCTGTTAATACTGCAGCGAACGCCACAGCTAATGCAACGGAAACAACCATGAATCAGGCAGG

and got this error:

[ERROR]: The vector holding the repeat indexes has less than 2 repeats!
libcrispr.cpp : 1028 : bool qcFoundRepeats(ReadHolder&, int, int)
[ERROR]: Fatal error in search algorithm!
libcrispr.cpp : 163 : int decideWhichSearch(const char*, const options&, ReadMap*, StringCheck*, lookupTable&, lookupTable&, time_t&)
[ERROR]: FATAL ERROR: parseSeqFiles failed
WorkHorse.cpp : 191 : int WorkHorse::doWork(Vecstr)

Could you please confirm that crass runs without error using this sequence with the latest version?

Thank you, Stephen

snayfach commented 7 years ago

Confirmed