search

darcyabjones / pante

A pipeline for predicting and masking transposable elements in multiple genomes.
Apache License 2.0
3 stars 10 forks source link

infernal issue #8

Open JWDebler opened 3 years ago

JWDebler commented 3 years ago

Hi Darcy, just tried running panTE over a few new assemblies and keep running into following error:

Error executing process > 'runInfernal (ArTR9571.contigs.racon.medaka.mito)'

Caused by:
  Process `runInfernal (ArTR9571.contigs.racon.medaka.mito)` terminated with an error exit status (137)

Command executed:

  SIZE=$(grep -v "^>" genome.fasta | sed 's/[[:space:]]//' | tr -d '\n' | wc -c)
  TRSIZE=$(perl -E "say ${SIZE} * 2 / 1e6")

  cmscan       --cpu 1       -Z "${TRSIZE}"       --cut_ga       --rfam       --nohmmonly       --tblout "ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.tblout"       --fmt 2       --clanin rfam/Rfam.clanin       rfam/Rfam.cm       chunk.fasta     > "ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.out"

  grep -v ' = ' "ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.tblout" > filtered.txt

  infernal-tblout2gff.pl       --cmscan       --fmt2       --all       -E "0.00001"       filtered.txt     > "cmscan.gff3.unclean"

  rm filtered.txt

Command exit status:
  137

Command output:
  (empty)

Command error:
  WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.
  .command.sh: line 5:   192 Killed                  cmscan --cpu 1 -Z "${TRSIZE}" --cut_ga --rfam --nohmmonly --tblout "ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.tblout" --fmt 2 --clanin rfam/Rfam.clanin rfam/Rfam.cm chunk.fasta > "ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.out"

Work dir:
  /data/rabieies_nanopore/pante/work/dc/2bf5bb151efb42939f65b02711bd4d

Tip: you can replicate the issue by changing to the process work dir and entering the command `bash .command.run`

Going to /data/rabieies_nanopore/pante/work/dc/2bf5bb151efb42939f65b02711bd4d and inspecting what's there:

-rw-rw-r-- 1 ubuntu ubuntu    0 Oct 26 02:10 .command.begin
-rw-rw-r-- 1 ubuntu ubuntu  478 Oct 26 02:19 .command.err
-rw-rw-r-- 1 ubuntu ubuntu  478 Oct 26 02:19 .command.log
-rw-rw-r-- 1 ubuntu ubuntu    0 Oct 26 02:10 .command.out
-rw-rw-r-- 1 ubuntu ubuntu 9.8K Oct 26 02:10 .command.run
-rw-rw-r-- 1 ubuntu ubuntu  682 Oct 26 02:10 .command.sh
-rw-r--r-- 1 root   root      0 Oct 26 02:10 .command.trace
-rw-rw-r-- 1 ubuntu ubuntu    3 Oct 26 02:19 .exitcode
-rw-r--r-- 1 root   root    27K Oct 26 02:18 ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.out
-rw-r--r-- 1 root   root      0 Oct 26 02:10 ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.tblout
lrwxrwxrwx 1 ubuntu ubuntu   80 Oct 26 02:10 chunk.fasta -> /data/rabieies_nanopore/pante/work/3d/81ee31298fb5a10019b89a69e6c0d8/out_5.fasta
lrwxrwxrwx 1 ubuntu ubuntu   88 Oct 26 02:10 genome.fasta -> /data/rabieies_nanopore/assembly/07-mitos_fixed/ArTR9571.contigs.racon.medaka.mito.fasta
lrwxrwxrwx 1 ubuntu ubuntu   72 Oct 26 02:10 rfam -> /data/rabieies_nanopore/pante/work/e4/611305d2d34d2cc2e42fd7107feed4/out

And the content of ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.out:

# cmscan :: search sequence(s) against a CM database
# INFERNAL 1.1.2 (July 2016)
# Copyright (C) 2016 Howard Hughes Medical Institute.
# Freely distributed under a BSD open source license.
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# query sequence file:                   chunk.fasta
# target CM database:                    rfam/Rfam.cm
# database size is set to:               83.7 Mb
# tabular output of hits:                ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.tblout
# tabular output format:                 2
# model-specific thresholding:           GA cutoffs
# Rfam pipeline mode:                    on [strict filtering]
# clan information read from file:       rfam/Rfam.clanin
# HMM-only mode for 0 basepair models:   no
# number of worker threads:              1 [--cpu]
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Query:       ArTR9571_ctg_91  [L=146227]
Hit scores:
 rank     E-value  score  bias  modelname  start    end   mdl trunc   gc  description
 ----   --------- ------ -----  --------- ------ ------   --- ----- ----  -----------

   [No hits detected that satisfy reporting thresholds]

Hit alignments:

   [No hits detected that satisfy reporting thresholds]

Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s):                                               1  (292454 residues searched)
Query sequences re-searched for truncated hits:                  1  (666.4 residues re-searched, avg per model)
Target model(s):                                              4070  (480450 consensus positions)
Windows   passing  local HMM SSV           filter:          774489  (0.1089); expected (0.06)
Windows   passing  local HMM Viterbi       filter:          179075  (0.02543); expected (0.02)
Windows   passing  local HMM Viterbi  bias filter:           86597  (0.009734); expected (0.02)
Windows   passing  local HMM Forward       filter:            8129  (0.001162); expected (0.0002)
Windows   passing  local HMM Forward  bias filter:            4513  (0.0006757); expected (0.0002)
Windows   passing glocal HMM Forward       filter:            2561  (0.0003754); expected (0.0002)
Windows   passing glocal HMM Forward  bias filter:            2167  (0.0003069); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter:            2125  (0.0001914); expected (0.0002)
Envelopes passing  local CM  CYK           filter:             615  (4.403e-05); expected (0.0001)
Total CM hits reported:                                          0  (0); includes 0 truncated hit(s)

# CPU time: 54.18u 0.39s 00:00:54.57 Elapsed: 00:00:56.69
//
Query:       ArTR9571_ctg_92  [L=145852]
Hit scores:
 rank     E-value  score  bias  modelname  start    end   mdl trunc   gc  description
 ----   --------- ------ -----  --------- ------ ------   --- ----- ----  -----------
  (1) !   1.4e-16   83.3   0.0  5S_rRNA    42435  42554 +  cm    no 0.49  5S ribosomal RNA
  (2) !   1.4e-16   83.3   0.0  5S_rRNA    50848  50729 -  cm    no 0.49  5S ribosomal RNA
  (3) !   9.9e-16   80.0   0.0  5S_rRNA    60411  60292 -  cm    no 0.48  5S ribosomal RNA

Hit alignments:
>> 5S_rRNA  5S ribosomal RNA
 rank     E-value  score  bias mdl mdl from   mdl to       seq from      seq to       acc trunc   gc
 ----   --------- ------ ----- --- -------- --------    ----------- -----------      ---- ----- ----
  (1) !   1.4e-16   83.3   0.0  cm        1      119 []       42435       42554 + .. 0.99    no 0.49

                                                 v      v        v         v                          vv           NC
                        (((((((((,,,,<<-<<<<<---<<--<<<<<<______>>-->>>>-.->>---->>>>>-->><<<-<<----<-<<-----<<___ CS
          5S_rRNA     1 gccuGcggcCAUAccagcgcgaAagcACcgGauCCCAUCcGaACuCcgA.AguUAAGcgcgcUugggCcagggUAGUAcuagGaUGgGuG 89   
                        :C:U:C::CCAUA::A::::GAAA: A :G:: CCC+U+CG  C::C:  A :UAAGC::::U+::G:C+G: UAGUA    G+UGGGUG
  ArTR9571_ctg_92 42435 ACAUACGACCAUAGGACGUUGAAAACAAGGCUUCCCGUUCGCUCAGCCCuAUUUAAGCAACGUACCGGCGGAUUAGUAGUUAGGUGGGUG 42524
                        ***********************************************877**************************************** PP

                                vv                     NC
                        _>>----->>->-->>->>>))))))))): CS
          5S_rRNA    90 AcCuCcUGggAAgaccagGugccgCaggcc 119  
                        ACC+C  G  AA+A:C G:UG::G:A:G:+
  ArTR9571_ctg_92 42525 ACCACUAGCGAAUACCCGCUGUUGUAUGUU 42554
                        ****************************** PP

>> 5S_rRNA  5S ribosomal RNA
 rank     E-value  score  bias mdl mdl from   mdl to       seq from      seq to       acc trunc   gc
 ----   --------- ------ ----- --- -------- --------    ----------- -----------      ---- ----- ----
  (2) !   1.4e-16   83.3   0.0  cm        1      119 []       50848       50729 - .. 0.99    no 0.49

                                                 v      v        v         v                          vv           NC
                        (((((((((,,,,<<-<<<<<---<<--<<<<<<______>>-->>>>-.->>---->>>>>-->><<<-<<----<-<<-----<<___ CS
          5S_rRNA     1 gccuGcggcCAUAccagcgcgaAagcACcgGauCCCAUCcGaACuCcgA.AguUAAGcgcgcUugggCcagggUAGUAcuagGaUGgGuG 89   
                        :C:U:C::CCAUA::A::::GAAA: A :G:: CCC+U+CG  C::C:  A :UAAGC::::U+::G:C+G: UAGUA    G+UGGGUG
  ArTR9571_ctg_92 50848 ACAUACGACCAUAGGACGUUGAAAACAAGGCUUCCCGUUCGCUCAGCCCuAUUUAAGCAACGUACCGGCGGAUUAGUAGUUAGGUGGGUG 50759
                        ***********************************************877**************************************** PP

                                vv                     NC
                        _>>----->>->-->>->>>))))))))): CS
          5S_rRNA    90 AcCuCcUGggAAgaccagGugccgCaggcc 119  
                        ACC+C  G  AA+A:C G:UG::G:A:G:+
  ArTR9571_ctg_92 50758 ACCACUAGCGAAUACCCGCUGUUGUAUGUU 50729
                        ****************************** PP

>> 5S_rRNA  5S ribosomal RNA
 rank     E-value  score  bias mdl mdl from   mdl to       seq from      seq to       acc trunc   gc
 ----   --------- ------ ----- --- -------- --------    ----------- -----------      ---- ----- ----
  (3) !   9.9e-16   80.0   0.0  cm        1      119 []       60411       60292 - .. 0.99    no 0.48

                                                 v      v        v         v                          vv           NC
                        (((((((((,,,,<<-<<<<<---<<--<<<<<<______>>-->>>>-.->>---->>>>>-->><<<-<<----<-<<-----<<___ CS
          5S_rRNA     1 gccuGcggcCAUAccagcgcgaAagcACcgGauCCCAUCcGaACuCcgA.AguUAAGcgcgcUugggCcagggUAGUAcuagGaUGgGuG 89   
                        :C:U:C::CCAUA::A::::GAAA: A :G:: CCC+U+CG  C::C:  A :UAAGC::::U+::G:C+G: UAGUA    G+U GGUG
  ArTR9571_ctg_92 60411 ACAUACGACCAUAGGACGUUGAAAACAAGGCUUCCCGUUCGCUCAGCCCuAUUUAAGCAACGUACCGGCGGAUUAGUAGUUAGGUGGGUG 60322
                        ***********************************************877**************************************** PP

                                vv                     NC
                        _>>----->>->-->>->>>))))))))): CS
          5S_rRNA    90 AcCuCcUGggAAgaccagGugccgCaggcc 119  
                        AC +C  G  AA+A:C G:UG::G:A:G:+
  ArTR9571_ctg_92 60321 ACUACUAGCGAAUACCCGCUGUUGUAUGUU 60292
                        ****************************** PP

Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s):                                               1  (291704 residues searched)
Query sequences re-searched for truncated hits:                  1  (666.4 residues re-searched, avg per model)
Target model(s):                                              4070  (480450 consensus positions)
Windows   passing  local HMM SSV           filter:          726130  (0.0989); expected (0.06)
Windows   passing  local HMM Viterbi       filter:          165058  (0.0222); expected (0.02)
Windows   passing  local HMM Viterbi  bias filter:          100638  (0.01146); expected (0.02)
Windows   passing  local HMM Forward       filter:            6672  (0.0009573); expected (0.0002)
Windows   passing  local HMM Forward  bias filter:            4039  (0.0006008); expected (0.0002)
Windows   passing glocal HMM Forward       filter:            2333  (0.0003388); expected (0.0002)
Windows   passing glocal HMM Forward  bias filter:            2053  (0.0002851); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter:            2006  (0.00018); expected (0.0002)
Envelopes passing  local CM  CYK           filter:             509  (3.693e-05); expected (0.0001)
Total CM hits reported:                                          3  (3.025e-07); includes 0 truncated hit(s)

# CPU time: 48.81u 0.32s 00:00:49.13 Elapsed: 00:00:50.74
//
Query:       ArTR9571_ctg_93  [L=145679]
Hit scores:
 rank     E-value  score  bias  modelname  start    end   mdl trunc   gc  description
 ----   --------- ------ -----  --------- ------ ------   --- ----- ----  -----------

   [No hits detected that satisfy reporting thresholds]

Hit alignments:

   [No hits detected that satisfy reporting thresholds]

Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s):                                               1  (291358 residues searched)
Query sequences re-searched for truncated hits:                  1  (666.4 residues re-searched, avg per model)
Target model(s):                                              4070  (480450 consensus positions)
Windows   passing  local HMM SSV           filter:          698962  (0.09389); expected (0.06)
Windows   passing  local HMM Viterbi       filter:          155150  (0.02009); expected (0.02)
Windows   passing  local HMM Viterbi  bias filter:          103846  (0.01182); expected (0.02)
Windows   passing  local HMM Forward       filter:            5808  (0.0008377); expected (0.0002)
Windows   passing  local HMM Forward  bias filter:            3668  (0.0005372); expected (0.0002)
Windows   passing glocal HMM Forward       filter:            2286  (0.0003309); expected (0.0002)
Windows   passing glocal HMM Forward  bias filter:            2062  (0.0002906); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter:            2028  (0.0001859); expected (0.0002)
Envelopes passing  local CM  CYK           filter:             433  (3.168e-05); expected (0.0001)
Total CM hits reported:                                          0  (0); includes 0 truncated hit(s)

# CPU time: 49.48u 0.45s 00:00:49.93 Elapsed: 00:00:51.75
//
Query:       ArTR9571_ctg_94  [L=131698]
Hit scores:
 rank     E-value  score  bias  modelname  start    end   mdl trunc   gc  description
 ----   --------- ------ -----  --------- ------ ------   --- ----- ----  -----------
  (1) !   1.1e-15   79.9   0.0  5S_rRNA   101863 101982 +  cm    no 0.49  5S ribosomal RNA

Hit alignments:
>> 5S_rRNA  5S ribosomal RNA
 rank     E-value  score  bias mdl mdl from   mdl to       seq from      seq to       acc trunc   gc
 ----   --------- ------ ----- --- -------- --------    ----------- -----------      ---- ----- ----
  (1) !   1.1e-15   79.9   0.0  cm        1      119 []      101863      101982 + .. 0.99    no 0.49

                                                  v      v        v         v                          vv         NC
                         (((((((((,,,,<<-<<<<<---<<--<<<<<<______>>-->>>>-.->>---->>>>>-->><<<-<<----<-<<-----<<_ CS
          5S_rRNA      1 gccuGcggcCAUAccagcgcgaAagcACcgGauCCCAUCcGaACuCcgA.AguUAAGcgcgcUugggCcagggUAGUAcuagGaUGgG 87    
                         :C:U:C::CCAUA::A::::GAAA: A :G:: CCC+U+CG  C::C:    :UAAGC::::U+::G:C+G: UAGUA    G+UGGG
  ArTR9571_ctg_94 101863 ACAUACGACCAUAGGACGUUGAAAACAAGGCUUCCCGUUCGCUCAGCCCuUUUUAAGCAACGUACCGGCGGAUUAGUAGUUAGGUGGG 101950
                         ***********************************************886899*********************************** PP

                                   vv                     NC
                         ___>>----->>->-->>->>>))))))))): CS
          5S_rRNA     88 uGAcCuCcUGggAAgaccagGugccgCaggcc 119   
                         UGACC+C  G  AA+A:C G:UG::G:A:G:+
  ArTR9571_ctg_94 101951 UGACCACUAGCGAAUACCCGCUGUUGUAUGUU 101982
                         ******************************** PP

Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s):                                               1  (263396 residues searched)
Query sequences re-searched for truncated hits:                  1  (666.4 residues re-searched, avg per model)
Target model(s):                                              4070  (480450 consensus positions)
Windows   passing  local HMM SSV           filter:          592710  (0.08444); expected (0.06)
Windows   passing  local HMM Viterbi       filter:          133762  (0.01824); expected (0.02)
Windows   passing  local HMM Viterbi  bias filter:          102230  (0.01299); expected (0.02)
Windows   passing  local HMM Forward       filter:            4788  (0.0007667); expected (0.0002)
Windows   passing  local HMM Forward  bias filter:            3335  (0.0005428); expected (0.0002)
Windows   passing glocal HMM Forward       filter:            1904  (0.0002984); expected (0.0002)
Windows   passing glocal HMM Forward  bias filter:            1717  (0.0002556); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter:            1697  (0.0001675); expected (0.0002)
Envelopes passing  local CM  CYK           filter:             354  (2.61e-05); expected (0.0001)
Total CM hits reported:                                          1  (1.117e-07); includes 0 truncated hit(s)

# CPU time: 40.34u 0.53s 00:00:40.87 Elapsed: 00:00:42.33
//
Query:       ArTR9571_ctg_95  [L=128392]
Hit scores:
 rank     E-value  score  bias  modelname  start    end   mdl trunc   gc  description
 ----   --------- ------ -----  --------- ------ ------   --- ----- ----  -----------

   [No hits detected that satisfy reporting thresholds]

Hit alignments:

   [No hits detected that satisfy reporting thresholds]

Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s):                                               1  (256784 residues searched)
Query sequences re-searched for truncated hits:                  1  (666.4 residues re-searched, avg per model)
Target model(s):                                              4070  (480450 consensus positions)
Windows   passing  local HMM SSV           filter:          601403  (0.0909); expected (0.06)
Windows   passing  local HMM Viterbi       filter:          134879  (0.01973); expected (0.02)
Windows   passing  local HMM Viterbi  bias filter:           90830  (0.01173); expected (0.02)
Windows   passing  local HMM Forward       filter:            5473  (0.0008914); expected (0.0002)
Windows   passing  local HMM Forward  bias filter:            3429  (0.0005684); expected (0.0002)
Windows   passing glocal HMM Forward       filter:            1958  (0.0003267); expected (0.0002)
Windows   passing glocal HMM Forward  bias filter:            1756  (0.000285); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter:            1735  (0.0001802); expected (0.0002)
Envelopes passing  local CM  CYK           filter:             430  (3.534e-05); expected (0.0001)
Total CM hits reported:                                          0  (0); includes 0 truncated hit(s)

# CPU time: 44.91u 0.51s 00:00:45.41 Elapsed: 00:00:46.77
//
Query:       ArTR9571_ctg_96  [L=126991]
Hit scores:
 rank     E-value  score  bias  modelname  start    end   mdl trunc   gc  description
 ----   --------- ------ -----  --------- ------ ------   --- ----- ----  -----------

   [No hits detected that satisfy reporting thresholds]

Hit alignments:

   [No hits detected that satisfy reporting thresholds]

Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s):                                               1  (253982 residues searched)
Query sequences re-searched for truncated hits:                  1  (666.4 residues re-searched, avg per model)
Target model(s):                                              4070  (480450 consensus positions)
Windows   passing  local HMM SSV           filter:          622243  (0.09705); expected (0.06)
Windows   passing  local HMM Viterbi       filter:          139745  (0.02119); expected (0.02)
Windows   passing  local HMM Viterbi  bias filter:           88235  (0.01159); expected (0.02)
Windows   passing  local HMM Forward       filter:            6124  (0.001047); expected (0.0002)
Windows   passing  local HMM Forward  bias filter:            3949  (0.0006942); expected (0.0002)
Windows   passing glocal HMM Forward       filter:            1892  (0.0003211); expected (0.0002)
Windows   passing glocal HMM Forward  bias filter:            1671  (0.0002712); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter:            1646  (0.0001713); expected (0.0002)
Envelopes passing  local CM  CYK           filter:             360  (2.954e-05); expected (0.0001)
Total CM hits reported:                                          0  (0); includes 0 truncated hit(s)

# CPU time: 41.42u 0.28s 00:00:41.70 Elapsed: 00:00:42.93
//
Query:       ArTR9571_ctg_97  [L=125463]
Hit scores:
 rank     E-value  score  bias  modelname  start    end   mdl trunc   gc  description
 ----   --------- ------ -----  --------- ------ ------   --- ----- ----  -----------
  (1) !   4.8e-25   94.9   0.0  Afu_309   108593 108324 -  cm    no 0.58  A. fumigatus sRNA Afu_309

Hit alignments:
>> Afu_309  A. fumigatus sRNA Afu_309
 rank     E-value  score  bias mdl mdl from   mdl to       seq from      seq to       acc trunc   gc
 ----   --------- ------ ----- --- -------- --------    ----------- -----------      ---- ----- ----
  (1) !   4.8e-25   94.9   0.0  cm        1      322 []      108593      108324 - .. 0.80    no 0.58

                                                                    vv           v      v          vv             NC
                         :::::::::::::::::((((((((<<<<<<-<<<<<<<<<<<<<<<<<-<<<-<<<<____>>>>>>>->>>>>>->>->.>>>>-- CS
          Afu_309      1 aucAauagAAcAaacaCaGAuCUGUGuCCAGCgcuCCugugCcagccgguggcccgccUUugggcggccUccggcuGgGUc.acgGUU 87    
                           +AA            ::::CUGUG CCAG ::UCCUG::C:              C UUGGG            G:GU: :CGGU 
  ArTR9571_ctg_97 108593 UGUAA------------CAGCCUGUG-CCAGUUUUCCUGUCCACC------------CCUUGGG------------GUGUGuUCGGUC 108543
                         *9999............********8.68**********977722............3444432............25555269**** PP

                                                v                                        v                        NC
                         >>>>->>>>>>,,,,,,,.<<<.<<--<<<-<<<________________>>>->>>------>>>>>)))))))),,,,,,,,,,<< CS
          Afu_309     88 GagcGCUGGaCAGUUCGA.CGa.ccuAuGgAgcCAUCaauuuucuUuuAUGguguCaAUUUCCgguCGACAGaUCuCAGAuugAaugc 173   
                         GA::GCUGG CAGU CG  CG:  C AUGGA::C UC        +    G::GUCAAU UCCG :CGACAG::::CAGA  +A U  
  ArTR9571_ctg_97 108542 GAGAGCUGG-CAGUCCGUuCGUgACCAUGGAGCCGUCUUGAG---CAGUGGACGUCAAUAUCCGAACGACAGGCUGCAGAGCAAGU-- 108461
                         *******86.8****9965787459*********99988776...44444*******************************98866.. PP

                                            v v                            v v                      v             NC
                         <---<<<<<<---------<<<<--<<<<<<.<<____>>-..>>>>>>>>>>------>>>>>>->>>,,,,<<<<<<<<------- CS
          Afu_309    174 cgacaccggGuGUuaacuucgcCUUgagcuC.CCguuuGGU..GagcucGgcggGAuagCccgguaggcuGaaGgCGcCAuAUUCCaa 258   
                             :C::G UG U       CC UGAG:UC CCG ++GGU  GA:CUCG    G  AG C::G:      A G:  :C :AUUCC+ 
  ArTR9571_ctg_97 108460 --CGGCGCGUUGCUGGAA-G-CC-UGAGUUCgCCGGAAGGUuuGAGCUCG--GUGGAAGGCGCGUG---CCAGGCAGACUGAUUCCUG 108383
                         ..3355555555444443.3.34.67777775889999888457777775..45555555555553...67889999*********** PP

                              v     v                     v   v                 v          NC
                         -<<<<<-.-<<<-----<<<<___>>>>----->>>->>>>>------>>>>>-->>>::::::: CS
          Afu_309    259 uuCCcuU.ugCCGauUuGgCcGUCgGcCgaUGAGGcUagGGaaaAACCaUGgCuaGcCaACAUuu 322   
                         UUCCC U UGC    U+G:CCGUCGG:C AUGA GCU GGGA AAACC: G:    :C ACAU+U
  ArTR9571_ctg_97 108382 UUCCCUUuUGC----UAGACCGUCGGUCCAUGACGCUUGGGACAAACCCAGUU--GGCUACAUAU 108324
                         *****862577....5***********************************98..9********* PP

Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s):                                               1  (250926 residues searched)
Query sequences re-searched for truncated hits:                  1  (666.4 residues re-searched, avg per model)
Target model(s):                                              4070  (480450 consensus positions)
Windows   passing  local HMM SSV           filter:          552504  (0.0817); expected (0.06)
Windows   passing  local HMM Viterbi       filter:          123778  (0.01734); expected (0.02)
Windows   passing  local HMM Viterbi  bias filter:           99084  (0.01324); expected (0.02)
Windows   passing  local HMM Forward       filter:            4292  (0.0006762); expected (0.0002)
Windows   passing  local HMM Forward  bias filter:            3126  (0.0004941); expected (0.0002)
Windows   passing glocal HMM Forward       filter:            1742  (0.0002881); expected (0.0002)
Windows   passing glocal HMM Forward  bias filter:            1615  (0.0002631); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter:            1608  (0.0001676); expected (0.0002)
Envelopes passing  local CM  CYK           filter:             321  (2.679e-05); expected (0.0001)
Total CM hits reported:                                          1  (2.637e-07); includes 0 truncated hit(s)

# CPU time: 39.20u 0.33s 00:00:39.53 Elapsed: 00:00:40.61
//
Query:       ArTR9571_ctg_98  [L=124139]
Hit scores:
 rank     E-value  score  bias  modelname  start    end   mdl trunc   gc  description
 ----   --------- ------ -----  --------- ------ ------   --- ----- ----  -----------

   [No hits detected that satisfy reporting thresholds]

Hit alignments:

   [No hits detected that satisfy reporting thresholds]

Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s):                                               1  (248278 residues searched)
Query sequences re-searched for truncated hits:                  1  (666.4 residues re-searched, avg per model)
Target model(s):                                              4070  (480450 consensus positions)
Windows   passing  local HMM SSV           filter:          560834  (0.08582); expected (0.06)
Windows   passing  local HMM Viterbi       filter:          124290  (0.01796); expected (0.02)
Windows   passing  local HMM Viterbi  bias filter:           93460  (0.01259); expected (0.02)
Windows   passing  local HMM Forward       filter:            4514  (0.0007523); expected (0.0002)
Windows   passing  local HMM Forward  bias filter:            3152  (0.0005322); expected (0.0002)
Windows   passing glocal HMM Forward       filter:            1929  (0.0003276); expected (0.0002)
Windows   passing glocal HMM Forward  bias filter:            1762  (0.0002931); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter:            1737  (0.0001891); expected (0.0002)
Envelopes passing  local CM  CYK           filter:             404  (3.413e-05); expected (0.0001)
Total CM hits reported:                                          0  (0); includes 0 truncated hit(s)

# CPU time: 45.59u 0.51s 00:00:46.10 Elapsed: 00:00:47.36
//
Query:       ArTR9571_ctg_99  [L=124046]
Hit scores:
 rank     E-value  score  bias  modelname  start    end   mdl trunc   gc  description
 ----   --------- ------ -----  --------- ------ ------   --- ----- ----  -----------

   [No hits detected that satisfy reporting thresholds]

Hit alignments:

   [No hits detected that satisfy reporting thresholds]

Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s):                                               1  (248092 residues searched)
Query sequences re-searched for truncated hits:                  1  (666.4 residues re-searched, avg per model)
Target model(s):                                              4070  (480450 consensus positions)
Windows   passing  local HMM SSV           filter:          560790  (0.08566); expected (0.06)
Windows   passing  local HMM Viterbi       filter:          124258  (0.01803); expected (0.02)
Windows   passing  local HMM Viterbi  bias filter:           92471  (0.01241); expected (0.02)
Windows   passing  local HMM Forward       filter:            4612  (0.0007524); expected (0.0002)
Windows   passing  local HMM Forward  bias filter:            3140  (0.0005153); expected (0.0002)
Windows   passing glocal HMM Forward       filter:            1837  (0.0003054); expected (0.0002)
Windows   passing glocal HMM Forward  bias filter:            1685  (0.000273); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter:            1671  (0.0001784); expected (0.0002)
Envelopes passing  local CM  CYK           filter:             342  (2.733e-05); expected (0.0001)
Total CM hits reported:                                          0  (0); includes 0 truncated hit(s)

# CPU time: 40.24u 0.47s 00:00:40.71 Elapsed: 00:00:42.27
//
Query:       ArTR9571_ctg_100  [L=123211]
Hit scores:
 rank     E-value  score  bias  modelname  start    end   mdl trunc   gc  description
 ----   --------- ------ -----  --------- ------ ------   --- ----- ----  -----------

   [No hits detected that satisfy reporting thresholds]

Hit alignments:

   [No hits detected that satisfy reporting thresholds]

Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s):                                               1  (246422 residues searched)
Query sequences re-searched for truncated hits:                  1  (666.4 residues re-searched, avg per model)
Target model(s):                                              4070  (480450 consensus positions)
Windows   passing  local HMM SSV           filter:          560535  (0.08603); expected (0.06)
Windows   passing  local HMM Viterbi       filter:          124731  (0.01831); expected (0.02)
Windows   passing  local HMM Viterbi  bias filter:           95103  (0.01287); expected (0.02)
Windows   passing  local HMM Forward       filter:            4099  (0.0006765); expected (0.0002)
Windows   passing  local HMM Forward  bias filter:            2824  (0.0004691); expected (0.0002)
Windows   passing glocal HMM Forward       filter:            1745  (0.0002895); expected (0.0002)
Windows   passing glocal HMM Forward  bias filter:            1587  (0.0002563); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter:            1567  (0.000165); expected (0.0002)
Envelopes passing  local CM  CYK           filter:             362  (3.044e-05); expected (0.0001)
Total CM hits reported:                                          0  (0); includes 0 truncated hit(s)

# CPU time: 40.37u 0.46s 00:00:40.83 Elapsed: 00:00:41.94
//

I restarted it a few times and it keeps crashing with the same error on all of the assemblies, just seems a matter of which one it picks first. Sometimes the .out file is empty.

darcyabjones commented 2 years ago

Hey sorry I missed this.

It looks like the program is running without issue. I suspect that you might just be running out of ram?

137 is supposed to be an out-of-memory exit code. Or maybe a segfault, but you don't have a core dump so probably not.

I don't know. Try increasing the amount of RAM allocated and see if you get further along? Looks like most of the ones that ran without incident in your example are relatively short (for your monster nanopore assemblies that is).