search

dincarnato / RNAFramework

RNA structure probing and post-transcriptional modifications mapping high-throughput data analysis
http://www.rnaframework.com
GNU General Public License v3.0
31 stars 11 forks source link

~/Software/RNAFramework/rf-fold -m 1 -g -md 50 -w -pk -ko 10 -pw 160 -po 37 -wt 30 -fw 300 -fo 30 rf-norm/FSE.xml -o rf-fold2 -ow #67

Closed wangguiqian closed 3 weeks ago

wangguiqian commented 3 weeks ago

this my command: ~/Software/RNAFramework/rf-fold -m 1 -g -md 50 -w -pk -ko 10 -pw 160 -po 37 -wt 30 -fw 300 -fo 30 rf-norm/FSE.xml -o rf-fold2 -ow

The rf-norm/FSE.xml file to show:

GGTTGTTGGCTGGCTAATGGCTGCACTTGTGACAGATCCATTATGCAAAGCACTGATATG GCTTATTTAAACGAGTACGGGGCTCTAGTGCAGCTCGACTAGAGCCCTGTAACGGTACTG ATACACAACATGTGTATCGTGCTTTTGACATCTACAACAAGGATGTTGCTTGTCTAGG NaN,NaN,NaN,NaN,0.675,1.000,0.710,0.677,0.440,0.458,0.023,0.345,0.404,0.295,0.132,0.480,0.414,0.366,0.335,0.031,0.125,0.102,0.024,0.140,0.281,0.283,0.786,0.647,0.955,0.395,0.830,1.000,0.038,0.008,0.083,0.311,0.126,0.000,0.000,0.000,0.000,0.000,0.105,0.254,0.019,0.171,0.382,0.453,1.000,0.043,0.050,0.110,0.282,0.199,0.375,0.487,0.134,0.516,0.978,0.198, 0.352,0.241,0.380,0.486,0.429,0.612,1.000,0.987,0.635,0.547,0.597,0.160,0.136,0.268,0.785,0.072,0.024,0.012,0.011,0.012,0.007,0.019,0.000,0.062,0.000,0.000,0.051,0.055,0.325,0.858,0.416,1.000,0.629,0.992,0.175,0.246,0.010,0.009,0.001,0.001,0.000,0.000,0.097,0.000,0.000,0.056,0.000,0.000,0.000,0.067,0.021,0.000,0.124,0.014,0.036,0.429,0.889,0.937,1.000,0.100, 0.015,0.119,0.028,0.004,0.005,0.016,0.428,1.000,0.676,0.966,0.261,0.006,0.000,0.004,0.003,0.000,0.000,0.000,0.000,0.010,0.102,0.210,NaN,0.268,0.037,0.525,0.202,1.000,0.114,0.093,0.000,0.000,0.093,0.285,0.152,0.987,0.115,0.068,NaN,NaN,0.116,0.000,NaN,0.000,0.000,1.000,0.046,0.239,0.391,0.000,0.000,NaN,NaN,NaN,NaN,NaN,NaN,NaN But I used the comand to run ,then get the basic result: image I thank the result is error .Please help for me .

Asperatus22 commented 3 weeks ago

Hi wangguiqian,

It look like everythings are ok.

Do you have your output in rf-fold2/structures and rf-fold2/images ?

the output you post show that the command folded 1 transcript (" [] Folded transcripts: 1") and none was discarded ("[] Discarded trancsripts: 0 total") the next line describe "0" failed

Lionel

wangguiqian commented 3 weeks ago

Hi Lionel, I got a empty result.

Please look: QQ_1724236605885 @ @Asperatus22

Hi wangguiqian,

It look like everythings are ok.

Do you have your output in rf-fold2/structures and rf-fold2/images ?

the output you post show that the command folded 1 transcript (" [] Folded transcripts: 1") and none was discarded ("[] Discarded trancsripts: 0 total") the next line describe "0" failed

Lionel

Asperatus22 commented 3 weeks ago

@wangguiqian in your command line your specify -o rf-fold2 not rf_fold do you have the same output with "tree rf-fold2" ?

wangguiqian commented 3 weeks ago

Hi Lionel, I got a empty result.

Please look: QQ_1724236605885 @ @Asperatus22

Hi wangguiqian, It look like everythings are ok. Do you have your output in rf-fold2/structures and rf-fold2/images ? the output you post show that the command folded 1 transcript (" [] Folded transcripts: 1") and none was discarded ("[] Discarded trancsripts: 0 total") the next line describe "0" failed Lionel

But i changed my command to ran get other results .Please look: QQ_1724236857285 My command 👍: ~/Software/RNAFramework/rf-fold -m 1 -g -md 50 -w -pk -ko 10 -pw 160 -po 37 -wt 30 -fw 300 -fo 30 rf-norm/FSE.xml -o rf-fold -ow

wangguiqian commented 3 weeks ago

@wangguiqian in your command line your specify -o rf-fold2 not rf_fold do you have the same output with "tree rf-fold2" ?

I used "mv rf-fold2 rf-fold" command to change the name

wangguiqian commented 3 weeks ago

Please you look: QQ_1724237117734

Asperatus22 commented 3 weeks ago

Check the error : [!] Error: environment variable DATAPATH is not set. check that the path to RNAstructure datatable are set in the variable DATAPATH

wangguiqian commented 3 weeks ago

Check the error : [!] Error: environment variable DATAPATH is not set. check that the path to RNAstructure datatable are set in the variable DATAPATH

But I don’t to set and install RNAstructure .I installed ViennaRNA to run,so my command parameter setting are different "-m 1"

dincarnato commented 3 weeks ago

@wangguiqian you are using -km 2 to run the pseudoknot prediction. This uses ShapeKnots, which is part of the RNAstructure package. If you want to use that one, you need to set the DATAPATH environment variable. Otherwise, switch to -km 1.

wangguiqian commented 3 weeks ago

@wangguiqian you are using -km 2 to run the pseudoknot prediction. This uses ShapeKnots, which is part of the RNAstructure package. If you want to use that one, you need to set the DATAPATH environment variable. Otherwise, switch to -km 1.

But when I went to run it again, I also got a lot of failures. Please look the photo : QQ_1724256056887 I really don’t know as the reason .

dincarnato commented 3 weeks ago

There are no errors/failures in that output. The program is running fine. I'll close this issue unless you have other problems.

wangguiqian commented 2 weeks ago

There are no errors/failures in that output. The program is running fine. I'll close this issue unless you have other problems.

Thank you