search

dongzhang0725 / PhyloSuite

PhyloSuite is an integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies
GNU General Public License v3.0
142 stars 24 forks source link

mafft with unforeseen problem #60

Open doranicole1990 opened 1 year ago

doranicole1990 commented 1 year ago

I try to mafft 13 PCGs of 29 species, The following error is always reported: Traceback (most recent call last): File "src\Lg_mafft.py", line 418, in run_command File "src\Lg_mafft.py", line 540, in align File "src\Lg_mafft.py", line 173, in back_trans File "src\Lg_mafft.py", line 154, in tocodon KeyError: '>K17_Diaulinopsis_sp__ATAATTTATTTGTTTATAATTTTTGATTCTTTTATTGTAATTATTGAAATAATTTTAATGGTTTTAATTTCTGTAGCTTTTTTAACTTTGTTAGAACGAAAAATTTTAGGGTATATTCAAATTCGTAAGGGTCCAAATAAAGTTGGATTTATGGGTTTACTTCAACCTTTTTCTGATGCAATTAAATTATTTAGAAAAGAAAATATAATAGTTTTAAAATCTAATTATTTTTT\n' this is ND1 sequence with 954 length(ATA...TAG)， I don't really know where is the problem? please help me.

dongzhang0725 commented 1 year ago

your fasta file is not in standard format, there should have a line break between sequence name and sequence.