Open mictadlo opened 5 years ago
The GBSX software utility (https://github.com/GenomicsCoreLeuven/GBSX) used by GB-eaSy cannot handle more than one adapter sequence. Since your reverse adapter sequence is (essentially) the reverse complement of the forward sequence, you might try just using the forward sequence as the ADAPTER_SEQ parameter; it's possible that GBSX automatically considers the reverse complement of the adapter sequence, although I can't say for sure.
Another suggestion is to run GB-eaSy twice, once with the forward adapter sequence and once with the reverse, and compare the results. There is some debate as to whether adapter trimming is necessary, particularly for reference-based alignment, so the choice of adapter here may not affect your final results.
Hi, According to
GB-eaSy_parameters.txt
I can only provide one adapter sequence.However, we have 2 adapter sequences (forward=
CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
and reserve=CWGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
).How is possible to provide 2 adapter sequences into
GB-eaSy_parameters.txt
?Thank you in advance,
Michal