> ## Quick example without off-target searching or annotation
> ## First generate data with the sgRNA_Design Function
> testseq <- "GGCAGAGCTTCGTATGTCGGCGATTCATCTCAAGTAGAAGATCCTGGTGCAGTAGG"
> usergenome <- "placeholder"
> gtfname <- "placeholder"
> alldata <- sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
Searching sequence for possible target sites
Error in `stringr::str_replace_all()`:
! `string` must be a vector, not a <DNAString> object.
Because stringr now requires vector inputs. You can fix this problem by calling as.character() on the DNAString object.
In my checks, I see:
Because stringr now requires vector inputs. You can fix this problem by calling
as.character()
on the DNAString object.