lzcode1991
commented
1 year ago I am getting this wired dataframe layout in running a small scale gRNA prediction.
sgRNA sequence PAM sequence Direction Start End GC content Homopolymer Self Complementary Doench Score MM0 MM1 MM2 MM3 MM4 Notes 1 TTTCTTCAGAGAATAGATAG TGG - 40 62 0.30 FALSE 0 1 0.671 1 0 9 226 285 2 ATAGATAGTGGCTGCACTTC TGG - 28 50 0.45 FALSE 0 1 0.285 1 0 4 44 86
it seems many column is off by 1 column.
Hi,
When I do the gRNA design for short sequence where only 2-3 gRNA exist, it worked very well. However, when I increased the input sequence length and there were 19 gRNA, the scores and the number of MM 0-4 all become abnormal. May I know how should I fix it?
Below is the code:
input_seq1<-"GTACAAGAACTCGGATAATGATAAAGTCCAGAAGTGCAGCCACTATCTATTCTCTGAAGAAATCACTTCTGGCTGTCAGTTGCAAAAAAAGGAGATCCACCTCTACCAAACATTTGTTGTTCAGCTCCAGGACCCACGGGAACCCAGGAGACAGGCCACACAGATGCTAAAACTGCAGAATCTGG"
input_genome<-BSgenome.Hsapiens.UCSC.hg19 input_gtf<-"hg19.refGene.gtf"
test_gRNA_search<-sgRNA_design(input_seq1, input_genome, input_gtf, "NGG", calloffs = TRUE, annotateoffs = TRUE)