Closed idazucchi closed 1 year ago
Human donor metadata All metadata is in a picture, I converted it to xlxs fromat --> here
Mouse host data Mice are employed as xenograft metastasis model. Mice are injected with H2087-LCCs (lung cell cancer) then:
We isolated lung cancer cells from two BLI-negative kidneys that showed no signs of metastasis, yet contained DTCs. We also isolated cancer cells from one case of incipient lung metastasis and from three individual lung macrometastases that evolved spontaneously. Cells were uniformly isolated through antibiotic selection for one passage in culture and then subjected to scRNA-seq. This selection step, which was essential because DTCs are extremely rare, likely has some effect on gene expression and is a limitation of our model.
H2087-LCCs were intracardially injected into the arterial circulation of athymic mice. Thirty days later, we administrated anti-GM1 antibody to trigger NK cell depletion which facilitates the robust outbreak of macrometastases as evidenced by BLI signal.
when reviewing please pay attention to the ontology terms and the inDrop library preparation (it would be good to review the entry in the cheat sheet) for the xenograft modelling I relied on the best practice document
Hello, Ida! Great job! Here are my comments.
Lung
atlas is now available in hca_bionetwork.hca_tissue_atlas
module in the latest update here.peerd@mskcc.org
& j-massague@ski.mskcc.org
No dissociation protocol for blood and other fluids
, since the cells are already separated. Here, since we don't have separate RBC suspension (would be considered an enrichment protocol), my suggestion would be to skip the red_blood_cells_lysis
protocol. I understand however that this is the most suitable place for this./5Acryd/PC/CGATGACGTAATACGACTCACTATAGGGATACCACCATGGCTCTTTCCCTACACGACGCTCTTCCGATCT[12345678901]GAGTGATTGCTTGTGACGCCTT[12345678]NNNNNNNNTTTTTTTTTTTTTTTTTTTV, where 5Acryd is an acrydite moiety, PC is a photo-cleavable spacer, the letters in bold indicate T7 RNA promoter sequence, and underlined letters indicate the site for Illumina PE Read 1 Sequencing primer. The numbers indicate cell barcodes, which were specifically designed for this experiment to have 50% GC content and Hamming distance of > = 3 between each pair of barcodes. For that reason, I think the length should be 19 instead of 16.
thank you for reviewing!
from my prerspective the point of red_blood_cells_lysis
as a dissociation protocol is to highlight that red blood cells have been excluded from the lung cell suspension. Since the methods say "Red blood cells were lysed in red blood cell lysis solution (once or twice depending on red blood cell content)" it felt like a meaningful thing to record
Library preparation --> I'm going to put 19 as cell barcode length for now, but I'm not sure what's the best way to represent split barcodes like this one. Is it more important to get the total barcode length or the nucleotide lenght in the read, also accounting for the gap?
Thanks for spotting the formula! I've checked the submission and it looks like the formula didn't make it to ingest, which is surprising If we get a weird validation issue it might be related this!
After discussing the dataset with the wrangler I've changed red_blood_cells_lysis
into an enrichment protocol and updated the cell barcode length for inDrop to 41, to include the spacer length
additional cellxgene info in this thread
Project short name:
RegenerativeLineagesLungMetastasis
Primary Wrangler:
Ida
Secondary Wrangler:
Arsenios
Associated files
Published study links
Paper: Regenerative lineages and immune-mediated pruning in lung cancer metastasis
Accessioned data: superseries GSE123904
Ingest
Key Events