extract: Outputs blank lines

edawson / gfakluge

A C++ library and utilities for manipulating the Graphical Fragment Assembly format.

http://edawson.github.io/gfakluge/

MIT License

51 stars 20 forks source link

extract: Outputs blank lines #48

Open sjackman opened 5 years ago

sjackman commented 5 years ago

gfak extract outputs blank lines. For example:

>7
CTCTTTTTTATTATAATGAAATTTGATTAGTAATAATTCTATTTTATTGTATTAAAAAACAAACTAC

>8
GGGTTTATTTGATCAATTTTTGCAATCAATTTCTTGAAACCG

>9
AGTATTGAATAAATACTATTTTGAATTAAAGAA

There are typically no blank lines in a FASTA file.

edawson commented 5 years ago

This is fixed in the latest release but hasn't made it to homebrew quite yet. I'll close once it's resolved globally!