Macro(Import FASTA): The ' * ' symbol occurring between two letters is not recognized as a break in peptide chain

[Zhirnoff]

Steps to Reproduce

1. Switch to Macro mode
2. Paste FASTA sequence with '*' between two letters and in the end (Not right away, but one by one)

   >M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
   GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCT*TGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA

   >M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
   GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA*

Actual behavior The ' * ' symbol occurring between two letters is not recognized as a break in peptide chain

Expected behavior The ' ' symbol occurring between two letters is recognized as a break in peptide chain (no bond should be created between monomers separated with the ""). "*" means the end of the peptide sequence https://github.com/epam/Indigo/issues/1755

Desktop (please complete the following information):

• OS: Windows 11
• Browser Chrome
• Version 112.0.5615.138 (Official Build) (64-bit)

Indigo version [Version 1.19.0-rc.1]

Attachments

[AlexeyGirin]

Fixed.

• Indigo Toolkit Version 1.19.0-rc.2.0-g6c0e3fecf-x86_64-linux-gnu-11.2.1
• Ketcher Version 2.20.0-rc2 Build at 2024-03-27; 08:30:51
• Chrome Version 122.0.6261.70 (Official Build) (64-bit)
• Win10