Macro(Import FASTA): The '>' symbol is not recognized as indicating a new sequence

[Zhirnoff]

Steps to Reproduce

1. Switch to Macro mode
2. Paste FASTA sequence with '>'

   >M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
   GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA
   >M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
   GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA

Actual behavior The '>' symbol is not recognized as indicating a new sequence

Expected behavior The '>' symbol is recognized as indicating a new sequence. Each sequence should be imported as a separate molecule. The start of the sequence is the first symbol in a line after header line, the end of the sequence is the last symbol before ">" https://github.com/epam/Indigo/issues/1755

Desktop (please complete the following information):

• OS: Windows 11
• Browser Chrome
• Version 112.0.5615.138 (Official Build) (64-bit)

Indigo version [Version 1.19.0-rc.1]

Attachments

[AlexeyGirin]

Fixed.

• Indigo Toolkit Version 1.19.0-rc.2.0-g6c0e3fecf-x86_64-linux-gnu-11.2.1
• Ketcher Version 2.20.0-rc2 Build at 2024-03-27; 08:30:51
• Chrome Version 122.0.6261.70 (Official Build) (64-bit)
• Win10