Macro(Import FASTA): The ';' symbol is not recognized as a comment

[Zhirnoff]

Steps to Reproduce

1. Switch to Macro mode
2. Paste FASTA sequence with ';'

   >M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
   GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA
   ;This is simple comment for this sequence > as it is
   >M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
   GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA

Actual behavior The ';' symbol is not recognized as a comment

Expected behavior The ';' symbol is recognized as a comment. The comments line starts with the semicolon ";" symbol and ends with newline. May contain any symbol (including ">") https://github.com/epam/Indigo/issues/1755

Desktop (please complete the following information):

• OS: Windows 11
• Browser Chrome
• Version 112.0.5615.138 (Official Build) (64-bit)

Indigo version [Version 1.19.0-rc.1]

Attachments

[AlexeyGirin]

Fixed.

• Indigo Toolkit Version 1.19.0-rc.2.0-g6c0e3fecf-x86_64-linux-gnu-11.2.1
• Ketcher Version 2.20.0-rc2 Build at 2024-03-27; 08:30:51
• Chrome Version 122.0.6261.70 (Official Build) (64-bit)
• Win10