search

epi2me-labs / pychopper

cDNA read preprocessing
Other
61 stars 9 forks source link

About Using User's Own Primer Sequences #26

Closed liuyh99 closed 1 year ago

liuyh99 commented 1 year ago

Hello, I want to use my own primer sequence to identify full field reads when using pychopper. I used - b and - c to specify my own primer sequence, referring to the standard format (file content is as follows), but it still appears when running the program using the default PCS109 primer sequence. How can I solve this problem?

'''my primer:

VNP AAAAAAAAAAAAAAAAAAAAGAAGATAGAGCGACAGGCAAGT SSP TTTCTGTTGGTGCTGATATTGCTGGG configurations: +:SSP,-VNP|-:VNP,-SSP'''

nrhorner commented 1 year ago

Hi @liuyh99

When specifying your own primers using -b, unfortunately you will still receive the following message Using kit: PCS109, but your custom primers will be used. This is confusing and I will get that fixed.

nrhorner commented 1 year ago

Hi @liuyh99

This issue should now be fixed in v2.7.7. Please get in touch if you have any more issues.

liuyh99 commented 1 year ago

Okay, thank you for the update.